Abstract
Begomoviruses and criniviruses, vectored by whiteflies (
Bemisia tabaci
), are important threats to crops worldwide. In recent years, the spread of cucurbit leaf crumple virus (CuLCrV), ...cucurbit yellow stunting disorder virus (CYSDV) and cucurbit chlorotic yellows virus (CCYV) on cucurbit crops has been reported to cause devastating crop losses in many regions of the world. In this study, a multiplex recombinase polymerase amplification (RPA) assay, an isothermal technique for rapid and simultaneous detection of DNA and RNA viruses CuLCrV, CYSDV and CCYV was developed. Highly specific and sensitive multiplex RPA primers for the coat protein region of these viruses were created and evaluated. The sensitivity of the multiplex RPA assay was examined using serially diluted plasmid containing the target regions. The results demonstrated that multiplex RPA primers have high sensitivity with a detection limit of a single copy of the viruses. The multiplex RPA primers were specific to the target as indicated by testing against other begomoviruses, potyviruses and an ilarvirus, and no nonspecific amplifications were noted. The primers simultaneously detected mixed infection of CCYV, CYSDV and CuLCrV in watermelon and squash crude extracts. This study is the first report of a multiplex RPA assay for simultaneous detection of mixed infection of DNA and RNA plant viruses.
Full text
Available for:
BFBNIB, DOBA, FZAB, GIS, IJS, IZUM, KILJ, NLZOH, NUK, OILJ, PILJ, PNG, SAZU, SBCE, SBMB, UILJ, UKNU, UL, UM, UPUK
The major components of RNA silencing include both transitive and systemic small RNAs, which are technically called secondary sRNAs. Double-stranded RNAs trigger systemic silencing pathways to ...negatively regulate gene expression. The secondary siRNAs generated as a result of transitive silencing also play a substantial role in gene silencing especially in antiviral defense. In this review, we first describe the discovery and pathways of transitivity with emphasis on RNA-dependent RNA polymerases followed by description on the short range and systemic spread of silencing. We also provide an in-depth view on the various size classes of secondary siRNAs and their different roles in RNA silencing including their categorization based on their biogenesis. The other regulatory roles of secondary siRNAs in transgene silencing, virus-induced gene silencing, transitivity, and
-species transfer have also been detailed. The possible implications and applications of systemic silencing and the different gene silencing tools developed are also described. The details on mobility and roles of secondary siRNAs derived from viral genome in plant defense against the respective viruses are presented. This entails the description of other compatible plant-virus interactions and the corresponding small RNAs that determine recovery from disease symptoms, exclusion of viruses from shoot meristems, and natural resistance. The last section presents an overview on the usefulness of RNA silencing for management of viral infections in crop plants.
In the scenario of global warming and climate change, an outbreak of new pests and pathogens has become a serious concern owing to the rapid emergence of arms races, their epidemic infection, and the ...ability to break down host resistance, etc. Fusarium head blight (FHB) is one such evidence that depredates major cereals throughout the world. The symptomatological perplexity and aetiological complexity make this disease very severe, engendering significant losses in the yield. Apart from qualitative and quantitative losses, mycotoxin production solemnly deteriorates the grain quality in addition to life endangerment of humans and animals after consumption of toxified grains above the permissible limit. To minimize this risk, we must be very strategic in designing sustainable management practices constituting cultural, biological, chemical, and host resistance approaches. Even though genetic resistance is the most effective and environmentally safe strategy, a huge genetic variation and unstable resistance response limit the holistic deployment of resistance genes in FHB management. Thus, the focus must shift towards the editing of susceptible (S) host proteins that are soft targets of newly evolving effector molecules, which ultimately could be exploited to repress the disease development process. Hence, we must understand the pathological, biochemical, and molecular insight of disease development in a nutshell. In the present time, the availability of functional genomics, proteomics, and metabolomics information on host-pathogen interaction in FHB have constructed various networks which helped in understanding the pathogenesis and coherent host response(s). So now translation of this information for designing of host defense in the form of desirable resistant variety/ genotype is the next step. The insights collected and presented in this review will be aiding in the understanding of the disease and apprise a solution to the multi-faceted problems which are related to FHB resistance in wheat and other cereals to ensure global food safety and food security.
After two years since the declaration of COVID-19 as a pandemic by the World Health Organization (WHO), more than six million deaths have occurred due to SARS-CoV-2, leading to an unprecedented ...disruption of the global economy. Fortunately, within a year, a wide range of vaccines, including pathogen-based inactivated and live-attenuated vaccines, replicating and non-replicating vector-based vaccines, nucleic acid (DNA and mRNA)-based vaccines, and protein-based subunit and virus-like particle (VLP)-based vaccines, have been developed to mitigate the severe impacts of the COVID-19 pandemic. These vaccines have proven highly effective in reducing the severity of illness and preventing deaths. However, the availability and supply of COVID-19 vaccines have become an issue due to the prioritization of vaccine distribution in most countries. Additionally, as the virus continues to mutate and spread, questions have arisen regarding the effectiveness of vaccines against new strains of SARS-CoV-2 that can evade host immunity. The urgent need for booster doses to enhance immunity has been recognized. The scarcity of “safe and effective” vaccines has exacerbated global inequalities in terms of vaccine coverage. The development of COVID-19 vaccines has fallen short of the expectations set forth in 2020 and 2021. Furthermore, the equitable distribution of vaccines at the global and national levels remains a challenge, particularly in developing countries. In such circumstances, the exigency of plant virus-based vaccines has become apparent as a means to overcome supply shortages through fast manufacturing processes and to enable quick and convenient distribution to millions of people without the reliance on a cold chain system. Moreover, plant virus-based vaccines have demonstrated both safety and efficacy in eliciting robust cellular immunogenicity against COVID-19 pathogens. This review aims to shed light on the advantages and disadvantages of different types of vaccines developed against SARS-CoV-2 and provide an update on the current status of plant-based vaccines in the fight against the COVID-19 pandemic.
Straightneck squash (Cucurbita pepo var. recticollis) is an important cucurbit crop in Florida. In early fall 2022, straightneck squash showing severe virus-like symptoms of yellowing, mild leaf ...crinkling (Supplementary Figure 1), unusual mosaic patterns and deformation on the surface of the fruit (Supplementary Figure 2), were observed in a ~15-ha straightneck squash field in Northwest FL with a disease incidence of ~ 30%. Based on the distinct symptoms and severity observed, multi-virus infection was hypothesized. Seventeen plants were sampled randomly for testing. Plants tested negative for zucchini yellow mosaic virus, cucumber mosaic virus, and squash mosaic virus, using ImmunoStrips® (Agdia, USA). Total RNA was extracted from 17 squash plants using Quick-RNA Mini Prep (Cat No.11-327, Zymo, USA). A conventional OneTaq® RT-PCR Kit (Cat No. E5310S, NEB, USA) was used to test plants for cucurbit chlorotic yellows virus (CCYV) (Jailani et al., 2021a) and watermelon crinkle leaf-associated virus (WCLaV-1) and WCLaV-2 (Hernandez et al., 2021). Plants were negative for CCYV and 12 out 17 plants were positive for WCLaV-1 and WCLaV-2 (genus Coguvirus, family Phenuiviridae) using specific primers targeting both RNA-dependent RNA polymerase (RdRP) and movement protein (MP) genes of both viruses (Hernandez et al., 2021). In addition, these 12 straightneck squash plants were also positive for watermelon mosaic potyvirus (WMV) based on RT-PCR and sequencing (Jailani et al., 2021b). The partial RdRP sequences for WCLaV-1 (OP389252) and WCLaV-2 (OP389254) shared 99% and 97.6% nt identity with isolates KY781184 and KY781187, respectively from China; the partial MP sequences for WCLaV-1 (OP389253) and WCLaV-2 (OP389255) shared 98.3% and 95.6% nt identity with isolate from Brazil (LC636069) and from China (MW751425), respectively. Additionally, the presence or absence of WCLaV-1 and WCLaV-2 were further confirmed using SYBR® Green-based real-time RT-PCR assay using different specific MP primers for WCLaV-1 (Adeleke et al., 2022), and newly designed specific MP primers for WCLaV-2 (WCLaV-2FP TTTGAACCAACTAAGGCAACATA/WCLaV-2RP-CCAACATCAGACCAGGGATTTA). Both viruses were detected in 12 out of 17 straightneck squash plants validating the conventional RT-PCR results. Co-infection of WCLaV-1 and WCLaV-2 with WMV resulted in more severe symptoms on leaves and fruits. Previously, both viruses were first reported in the USA on watermelon in Texas, (Hernandez et al., 2021), Florida (Hendricks et al., 2021), OK (Gilford and Ali., 2022), GA (Adeleke et al., 2022) and Zucchini in Florida (Iriarte et al., 2023). This is the first report of WCLaV-1 and WCLaV-2 on straightneck squash in the United States. These results indicate that WCLaV-1 and WCLaV-2 either in single or mixed infections are effectively spreading to other cucurbits beyond watermelon in FL. The need to assess mode(s) of transmission of these viruses is becoming more critical to develop best management practices.
Molecular cloning, a crucial prerequisite for engineering plasmid constructs intended for functional genomic studies, relies on successful restriction and ligation processes. However, the lack of ...unique restriction sites often hinders construct preparation, necessitating multiple modifications. Moreover, achieving the successful ligation of large plasmid constructs is frequently challenging. To address these limitations, we present a novel PCR strategy in this study, termed 'long-fragment circular-efficient PCR' (LC-PCR). This technique involves one or two rounds of PCR with an additional third-long primer that complements both ends of the newly synthesized strand of a plasmid construct. This results in self-circularization with a nick-gap in each newly formed strand. The LC-PCR technique was successfully employed to insert a partial sequence (210 nucleotides) of the phytoene desaturase gene from
and a full capsid protein gene (770 nucleotides) of a
(tomato leaf curl New Delhi virus) into a 16.4 kb infectious construct of a
, cucumber green mottle mosaic virus (CGMMV), cloned in pCambia. This was done to develop the virus-induced gene silencing vector (VIGS) and an expression vector for a foreign protein in plants, respectively. Furthermore, the LC-PCR could be applied for the deletion of a large region (replicase enzyme) and the substitution of a single amino acid in the CGMMV genome. Various in planta assays of these constructs validate their biological functionality, highlighting the utility of the LC-PCR technique in deciphering plant-virus functional genomics. The LC-PCR is not only suitable for modifying plant viral genomes but also applicable to a wide range of plant, animal, and human gene engineering under in-vitro conditions. Additionally, the LC-PCR technique provides an alternative to expensive kits, enabling quick introduction of modifications in any part of the nucleotide within a couple of days. Thus, the LC-PCR proves to be a suitable 'all in one' technique for modifying large plasmid constructs through site-directed gene insertion, deletion, and mutation, eliminating the need for restriction and ligation.
Full text
Available for:
IZUM, KILJ, NUK, PILJ, PNG, SAZU, UL, UM, UPUK
M (PVM) is one of the most prevalent viruses infecting potatoes worldwide, showing a wide range of diversity in their populations; however, the diversity and genome information of PVM occurring in ...India is hardly known. The present study serologically detected the PVM in 22.8% of leaf samples collected from the potato fields, generated 13 coat protein (CP) genes and one complete genome sequence for the isolates from India, and identified four differential hosts confirming PVM-Del-144 as a distinct strain of PVM occurring in India. The phylogenetic analyses conducted based on the CP gene sequences (14 from India and 176 from other countries) suggested the existence of three evolutionary divergent lineages (PVM-o, PVM-d, and a new divergent group) in the PVM population, where isolates from India belong to only two clusters (PVM-o and PVM-d) within four sub-clusters. High levels of nucleotide diversity (0.124) and genetic distance (0.142) recorded among the isolates from India may be due to the deviation from the neutral evolution and experiencing population expansion in the past. The complete genome of the isolate Del-144 (KJ194171; 8,526 nucleotides) shared 92.2-93.9% nt sequence identity with the population of PVM-o, whereas it shared only 70.2-72.1% identity with PVM-d. In the phylogenetic analyses, Del-144 clustered with the isolates of PVM-o; however, it formed a separate branch away from all other isolates, indicating the diversity of the strain. Overall, this study revealed the diversity of the isolates of PVM from India and reported the first complete genome sequence of a distinct strain of PVM occurring in India.
Golden trumpet (
Allamanda cathartica
) plants were observed to exhibit mottling and distortion symptoms on leaves. The genome of an associated begomovirus (Al-K1) was amplified by rolling-circle ...amplification, cloned, and sequenced. The viral genome consisted of two circular ssDNA molecules, and the organization of the ORFs was similar to those of DNA-A and DNA-B components of bipartite begomoviruses. The size of DNA-A (KC202818) and DNA-B (MG969497) of the begomovirus was 2772 and 2690 nucleotides, respectively. Sequence analysis revealed that the DNA-A and DNA-B components shared the highest sequence identity with duranta leaf curl virus (MN537564, 87.8%) and cotton leaf curl Alabad virus (MH760452, 81.0%), respectively. Interestingly, the Al-K1 isolate shared significantly less nucleotide sequence identity with allamanda leaf curl virus (EF602306, 71.6%), the only monopartite begomovirus reported previously in golden trumpet from China. Al-K1 shared less than 91% sequence identity with other begomoviruses, and hence, according to the latest ICTV guidelines for species demarcation of begomoviruses, Al-K1 is proposed to be a member of a new species, and we propose the name "allamanda leaf mottle distortion virus" (AllLMoDV-IN-Al_K1-12) for this virus. AllLMoDV was detected in various golden trumpet samples from different locations by PCR with specific primers based on the genome sequence determined in this study. Our study provides evidence of the occurrence of a new bipartite begomovirus in a perennial ornamental plant in India.
Full text
Available for:
EMUNI, FIS, FZAB, GEOZS, GIS, IJS, IMTLJ, KILJ, KISLJ, MFDPS, NLZOH, NUK, OILJ, PNG, SAZU, SBCE, SBJE, SBMB, SBNM, UKNU, UL, UM, UPUK, VKSCE, ZAGLJ
Expanding possibilities for foreign gene expression in cucurbits, we present a novel approach utilising a bipartite vector system based on the cucumber green mottle mosaic virus (CGMMV) genome. ...Traditional full-length CGMMV vectors face limitations such as a restricted cargo capacity and unstable foreign gene expression. To address these challenges, we developed two 'deconstructed' CGMMV genomes, DG-1 and DG-2. DG-1 features a major internal deletion, resulting in the loss of crucial replicase enzyme domains, rendering it incapable of self-replication. However, a staggered infiltration of DG-1 in CGMMV-infected plants enabled successful replication and movement, facilitating gene-silencing experiments. Conversely, DG-2 was engineered to enhance replication rates and provide multiple cloning sites. Although it exhibited higher replication rates, DG-2 remained localised within infiltrated tissue, displaying trans-replication and restricted movement. Notably, DG-2 demonstrated utility in expressing GFP, with a peak expression observed between 6 and 10 days post-infiltration. Overall, our bipartite system represents a significant advancement in functional genomics, offering a robust tool for foreign gene expression in
.
Microbes hold immense potential, based on the fact that they are widely acknowledged for their role in mitigating the detrimental impacts of chemical fertilizers and pesticides, which were ...extensively employed during the Green Revolution era. The consequence of this extensive use has been the degradation of agricultural land, soil health and fertility deterioration, and a decline in crop quality. Despite the existence of environmentally friendly and sustainable alternatives, microbial bioinoculants encounter numerous challenges in real-world agricultural settings. These challenges include harsh environmental conditions like unfavorable soil pH, temperature extremes, and nutrient imbalances, as well as stiff competition with native microbial species and host plant specificity. Moreover, obstacles spanning from large-scale production to commercialization persist. Therefore, substantial efforts are underway to identify superior solutions that can foster a sustainable and eco-conscious agricultural system. In this context, attention has shifted towards the utilization of cell-free microbial exudates as opposed to traditional microbial inoculants. Microbial exudates refer to the diverse array of cellular metabolites secreted by microbial cells. These metabolites enclose a wide range of chemical compounds, including sugars, organic acids, amino acids, peptides, siderophores, volatiles, and more. The composition and function of these compounds in exudates can vary considerably, depending on the specific microbial strains and prevailing environmental conditions. Remarkably, they possess the capability to modulate and influence various plant physiological processes, thereby inducing tolerance to both biotic and abiotic stresses. Furthermore, these exudates facilitate plant growth and aid in the remediation of environmental pollutants such as chemicals and heavy metals in agroecosystems. Much like live microbes, when applied, these exudates actively participate in the phyllosphere and rhizosphere, engaging in continuous interactions with plants and plant-associated microbes. Consequently, they play a pivotal role in reshaping the microbiome. The biostimulant properties exhibited by these exudates position them as promising biological components for fostering cleaner and more sustainable agricultural systems.
Full text
Available for:
DOBA, IZUM, KILJ, NUK, PILJ, PNG, SAZU, SIK, UILJ, UKNU, UL, UM, UPUK