Loss of heterozygosity (LOH) of loci on chromosome 18q occurs in a majority of colorectal cancers. The DPC4 (Smad4) tumor suppressor gene, located at 18q21.1, may be a predisposing gene for Juvenile ...Polyposis Syndrome. To investigate alterations of the DPC4 gene in sporadic colon adenocarcinoma, a panel of 60 tumor specimens from Croatian patients was surveyed for evidence of LOH and also for mutations within the entire DPC4 coding region (exons 1-11). Using three pairs of specific primers for the three DPC4 microsatellite repetitive sequences, we investigated the frequency of LOH. The presence of single nucleotide change at restriction sites of specific codons in exons 2, 8, 10, and 11 (which belong to the conserved region of the gene) was examined by RFLP analysis. The investigation was extended to search for any other mutation within the entire coding region of the DPC4 gene by single strand conformation polymorphism (SSCP) analysis. Our results show a high frequency of heterozygosity in 58 of 60 (97%) colon adenocarcinoma samples. LOH at any one of the three flanking markers was observed in 26 (45%) of the 58 informative cases. The loss of one allele of the DPC4 gene was negatively correlated with tumor size; more frequent in smaller tumors (<5 cm) than in larger ones. A mutation was found in exon 11 in only one tumor sample (T18), and the mutation was verified by sequencing. Sequencing demonstrated a novel mutation-a deletion in exon 11 (134-153 del TAGACGAAGTACTTCATACC) of the DPC4 gene in the MH2 domain. These data suggest that inactivation of the DPC4 gene contributes to the genesis of colorectal carcinoma through allelic loss whereas mutation in the coding region of the DPC4 gene is infrequently detected in Croatian patients with A, B or C stages of colorectal cancers.
Full text
Available for:
GEOZS, IJS, IMTLJ, KILJ, KISLJ, NUK, OILJ, PNG, SAZU, SBCE, SBJE, UL, UM, UPCLJ, UPUK
A case-control study was performed to establish a potential association of two TNF- alpha gene promoter SNPs (a degree 238G>A and a degree 308G>A) with occurrence of type 1 Diabetes mellitus (T1DM) ...in Croatian population (174 patients and 193 healthy controls). Genotypes (obtained by polymerase chain reaction-restriction fragment length polymorphism), and the clinical parameters of T1DM patients were statistically evaluated by SPSS 13 and Arlequin software, G*Power 3.0.10 program, and calculator for Hardy-Weinberg equilibrium. The frequency of the risk (A) allele, as well as the distribution of high-expression (GA, AA) genotypes were significantly higher (p < 0.0001) in T1DM patients only at locus a degree 308. The distribution of the a degree 238G/a degree 308A haplotype was also significantly higher in patients compared with controls (27.6% vs 9.6%, p < 0.0001). Gender-dependent analysis revealed that female T1DM a degree 308GA genotype carriers exhibit considerably stronger association with T1DM (odds ratio = 6.37, 95% confidence interval = 3.16-12.85) than male a degree 308GA patients (odds ratio = 2.71, 95% confidence interval = 1.31-5.59). Clinical parameter analysis of T1DM patients revealed significantly decreased level of hemoglobin A1c (HbA1c) in a degree 238A allele carriers compared with a degree 238G allele carriers (6.55% vs 7.17%, p = 0.022), as well as the tendency of the risk allele carriers at a degree 238 or a degree 308 locus to develop T1DM earlier in life compared with non-risk allele carriers. In conclusion, susceptibility to T1DM in the Croatian population is strongly associated with the TNF- alpha a degree 308G>A polymorphism, especially in women. In addition, significantly lower HbA1c levels found in T1DM a degree 238A allele carriers might indicate better glycemic control in these patients.
Full text
Available for:
GEOZS, IJS, IMTLJ, KILJ, KISLJ, NUK, OILJ, PNG, SAZU, SBCE, SBJE, UL, UM, UPCLJ, UPUK
Potassium bisperoxo(1,10-phenanthroline)oxovanadate, bpV(phen), a powerful protein phosphotyrosine phosphatase inhibitor and a potent insulinomimetic, influenced three fundamental cellular processes ...in HL-60 human leukemic cells: 1) inhibition of proliferation, 2) induction of differentiation and 3) apoptotic cell death. In the presence of micromolar concentrations of bpV(phen) cell number and DNA synthesis decreased progressively with time of incubation. A single treatment with bpV(phen) (3 μM) activated a differentiation program; after 6 days of incubation 82% of cells were differentiated, but differentiation started already within the first 24 h. Concentrations of 5–10 μM bpV(phen) caused the characteristic DNA ladder pattern, starting after 4.5 h. Differentiation in HL-60 cells appear to be associated with activation of extracellular signal-regulated kinase while apoptosis is connected with phosphorylation and activation of both extracellular signal-regulated kinase and c-Jun N-terminal kinase in a concentration and time-dependent manner. The antiproliferative and apoptotic action of bpV(phen) could be exploited in combination chemotherapy in leukemia.
Full text
Available for:
GEOZS, IJS, IMTLJ, KILJ, KISLJ, NUK, OILJ, SAZU, SBCE, SBJE, UL, UM, UPCLJ, UPUK
Background and Purpose: Increased activity of sucrase, one of the
intestinal alpha-glucosidase founded in diabetes mellitus. Inhibition of sucrase activity, plays a major role in preventing rise in ...postprandial glucose level in diabetics. On peer-reviewed literature could be found regarding investigation the effect of mixture plant proteins, Mw 3 – 15 kDa (MPP), isolated from Astragali radix – Astragalus membranaceus Fisch., Foenugraeci semen – Trigonella foenum graecum L., Cichorii radix – Cichorium Intybus L. and Urticae radix and herba – Urtica dioica L. on sucrase activity. This plants are used in traditional medicine of treatment of diabetes mellitus. The aim of this study was to determine activity of sucrase in small intestinal homogenates of NOD diabetic mice on feeding with and without MPP in chow.
Materials and Methods: In mice diabetes was induced by i.v. injection
of aloxan-monohydrate (75 mg/kg b.m.) seven days before treatment with MPP. The proteins (Mw 3 – 15 kDa), were isolated from ethanol extract, each plants separately, by gel filtration method on Sephadex G-25 column. Eluted fraction which highest absorbance on 280 nm were pooled, dialyzed, lyophilized and mixed (MPP) and before treatment in mice solvent in sterile PBS. After seven days of treatment diabetic NOD mice with MPP (1,8 g/d), the small intestine was removed and divided into three segments, from pylorus to duodenum, and two equal lengths of the jejunum and ileum and homogenized in cold 0.14M KCl. Specific sucrase activity was determined using method of Dahlquist et. al., by sucrose as substrate.
Results and Conclusion: We confirmed the increased specific sucrase
activity in the intestine of diabetic NOD mice. Our results also indicate that
MPP have strongly inhibitory potential on intestinal sucrase activity
(p<0.05) in diabetic mice. Conclusions drawn from this study should be
further supported and our future experiments will be focused on determining the amino acid sequence of each protein from MPP.
Galectin-3 is a β-galactoside-binding lectin that has been implicated in numerous physiological processes, including mRNA splicing, cell differentiation, tumor metastasis and the stress response. We ...have studied effects of transfer of resident murine peritoneal macrophages to in vitro conditions on galectin-3 in different cell compartments. Galectin-3 was purified by immunoprecipitation with rat monoclonal antibody M3/38, and analyzed by immunoblotting using the same antibody. Transfer to in vitro conditions nearly doubled the total amount of galectin-3 in cells, and caused significant alterations in its intracellular distribution, indicating that galectin-3 is involved in the adaptation of peritoneal macrophages to in vitro conditions.
Istraživački tim NBKO (nuklearno-biološko-kemijske obrane) radi na pronalasku i razvoju pripravka za dekontaminaciju kože od živčanih bojnih otrova. Cilj ovog istraživanja bio je ispitati ...dekontaminacijska svojstva (adsorpcijska i/ili kemisorpcijska) pripravka MCC® rabeći živčani bojni otrov sarin kao kožni kontaminant u uvjetima in vivo. MCC® je sintetski pripravak koji je biokemijski aktivan i ima ionskoizmjenjivačka i adsorpcijska svojstva. Istraživanje u uvjetima in vivo napravljeno je na miševima aplikacijom rastućih doza sarina na kožu životinje. Pripravak MCC® uporabljen je kao kožni dekontaminant neposredno nakon kožne kontaminacije sarinom. Istraživanja su pokazala da pripravak MCC® posjeduje adsorpcijska svojstva, ujedno važna za dekontaminaciju živčanih bojnih otrova. Eksperimenti u uvjetima in vivo na miševima (NOD-soj) pokazali su da se dekontaminacijom pripravkom MCC® može postići terapijski učinak od 3 LD50 (perkutano, sarin).
Cilj ovog istraživanja bio je ispitati dekontaminacijska (adsorpcijska) svojstva pripravka MCC® (Mineral Cationic Carrier) rabeći kožni bojni otrov iperit kao kontaminant u uvjetima in vivo. MCC® je ...sintetski pripravak koji je biokemijski aktivan i ima ionskoizmjenjivačka i adsorpcijska svojstva. Istraživanje u uvjetima in vivo provedeno je na miševima (soj CBA), aplikacijom rastućih doza iperita na kožu životinje. Pripravak MCC® uporabljen je kao kožni dekontaminant neposredno nakon perkutane kontaminacije iperitom. Rezultati istraživanja pokazuju da se dekontaminacijom pripravkom MCC® može postići terapijski učinak od 8,4 LD50 (perkutano, iperit). Dobiveni rezultati potvrđuju vrlo dobru dekontaminacijsku učinkovitost pripravka MCC® i govore u prilog daljnjim istraživanjima s ciljem njegove moguće šire primjene.
Acute, subchronic and chronic effects of the P-9801091 plant mixture extract at a dose of 20 mg/kg body mass were assessed
in serum of healthy CBA/HZg mice at 24 hours, 7 days, 3 months and 6 months ...of treatment (experimental group),
and compared with the values obtained in the control group of untreated healthy CBA/HZg mice. The P-9801091 plant
mixture extract is an antihyperglycemic preparation containing Myrtilli folium (Vaccinium myrtillus L.), Taraxaci radix
(Taraxacum officinale Web.), Cichorii radix (Cichorium intybus L.), Juniperi fructus (Juniperus communis L.), Centaurii
herba (Centaurium umbellatum Gilib.), Phaseoli fructus sine semine (Phaseolus vulgaris L.), Millefolii herba (Achillea
millefolium L.), Mori folium (Morus nigra L.), Valerianae radix (Valeriana officinalis L.) and Urticae herba et radix
(Urtica dioica L). Toxic effect of the P-9801091 plant mixture extract was assessed by the following biochemical parameters:
urea, creatinine, aspartate aminotransferase (AST), alanine aminotransferase (ALT) and cholesterol. Also, histopathological
examination of the kidneys, liver, spleen, pancreas, testes and lungs was performed. Results of biochemical
testing performed at specified time points generally showed no statistically significant differences from control values,
with the only exception of the catalytic concentration of AST in the experimental group measured on day 7, which was
significantly increased as compared with the control group (p<0.05). Pathohistological examination including characteristic
organ and tissue structure, and parenchyma relationship to the adjacent blood vessels and connective tissue in
the examined organs revealed no major pathologic changes.
The aim of this study was to improve detection of heterozygous samples and loss of heterozygosity
using a new type of gel polymer. A total of 60 samples of normal and tumor colon tissue
were tested. ...Elctrophoresis of amplified loci was performed on a standard acrylamide / N,Nmethylenebisacrylamide
gel, and the same gel containing Spreadex polymer, NAB (native acrylamide-
bis). Standard gel displayed 36 samples of normal tissue as homozygous. Electrophoresis
of the same samples on gel with addition of polymer revealed 12/36 heterozygous samples.
Five of 12 matched tumor samples displayed loss of heterozygosity that could not be detected
on standard gel, because of its lower resolving power. Electrophoresis on a new polymer presents
a simple, inexpensive, reproducible and non-radioactive method for loss of heterozygosity
detection, with improved performances such as increased sensitivity, decreased amount of a
sample and improved separation of closely spaced bands. Application of the polymer may contribute
to a vide variety of diagnostic procedures.
Full text
Available for:
IZUM, KILJ, NUK, PILJ, PNG, SAZU, UL, UM, UPUK
PDF
