Oncolytic virotherapy is a rapidly progressing field that uses oncolytic viruses (OVs) to selectively infect malignant cells and cause an antitumor response through direct oncolysis and stimulation ...of the immune system. Despite demonstrated pre-clinical efficacy of OVs in many cancer types and some favorable clinical results in glioblastoma (GBM) trials, durable increases in overall survival have remained elusive. Recent evidence has emerged that tumor-associated macrophage/microglia (TAM) involvement is likely an important factor contributing to OV treatment failure. It is prudent to note that the relationship between TAMs and OV therapy failures is complex. Canonically activated TAMs (i.e., M1) drive an antitumor response while also inhibiting OV replication and spread. Meanwhile, M2 activated TAMs facilitate an immunosuppressive microenvironment thereby indirectly promoting tumor growth. In this focused review, we discuss the complicated interplay between TAMs and OV therapies in GBM. We review past studies that aimed to maximize effectiveness through immune system modulation-both immunostimulatory and immunosuppressant-and suggest future directions to maximize OV efficacy.
Glioblastoma multiforme (GBM) is an aggressive primary brain cancer that includes focal amplification of PDGFRα and for which there are no effective therapies. Herein, we report the development of a ...genetically engineered mouse model of GBM based on autocrine, chronic stimulation of overexpressed PDGFRα, and the analysis of GBM signaling pathways using proteomics. We discover the tubulin-binding protein Stathmin1 (STMN1) as a PDGFRα phospho-regulated target, and that this mis-regulation confers sensitivity to vinblastine (VB) cytotoxicity. Treatment of PDGFRα-positive mouse and a patient-derived xenograft (PDX) GBMs with VB in mice prolongs survival and is dependent on STMN1. Our work reveals a previously unconsidered link between PDGFRα activity and STMN1, and highlight an STMN1-dependent cytotoxic effect of VB in GBM.
Abstract
Glioblastoma multiforme (GBM) is the most common and aggressive primary brain tumor in adults, which initiation and progression is driven by a subset of self-renewing GBM stem-like cells ...(GSCs). Long-non coding RNAs (lncRNAs) have been recently shown to play important roles in regulating numerous biological processes both in physiologic and pathologic condition. Identification of functional lncRNAs important for GBM initiation and progression may shed new light on understanding pathophysiology of the disease. We used a custom made lncRNA Nanostring platform to profile the expression of lncRNAs in subtype-characterized collection of patient-derived GSCs. We demonstrated that lncRNA signature may distinguish between GSC subtypes. Out of 73 lncRNAs we found 7 that were overexpressed specifically in the most aggressive mesenchymal (M) GSC subtype. Among them, HIF1A-AS2 was the most differentially expressed lncRNA. HIF1A-AS2 was reported to be overexpressed in many types of cancers; however its biological function and its role in GBM progression are unknown. Knockdown of HIF1A-AS2 in M GSCs resulted in reduced growth, increased cytotoxicity, and it strongly inhibited their neurosphere formation capability. Using more global approach we found out that knockdown of HIF1A-AS2 in M GSCs caused deregulation of several out of 730 cancer-related genes. Functional bioinformatic analysis revealed that these differentially expressed mRNAs are closely related to proliferation, transcriptional regulation and cell division. RNA pull-down assay showed that HIF1A-AS2 may exert its effects through specific binding of RNA helicase DHX9, a multifunctional protein with important roles in transcription, pre-mRNA processing and translation. We also demonstrated that HMGA1, a gene known to be regulated by DHX9, was specifically down-regulated in HIF1A-AS2 knockdown cells both at mRNA and protein level. Finally, we showed that silencing of HIF1A-AS2 blocked M GSC tumor growth in vivo resulting in significant survival benefits. Taken together, our results suggest HIF1A-AS2 as an important lncRNA in pathophysiology of GBM.
Citation Format: Marco Mineo, Franz Ricklefs, Arun Rooj, Shawn M. Lyons, Pavel Ivanov, Ennio A. Chiocca, Jakub Godlewski, Agnieszka Bronisz. The long non-coding RNA HIF1A-AS2 regulates mesenchymal glioma stem cell tumorigenicity. abstract. In: Proceedings of the 107th Annual Meeting of the American Association for Cancer Research; 2016 Apr 16-20; New Orleans, LA. Philadelphia (PA): AACR; Cancer Res 2016;76(14 Suppl):Abstract nr 1000.
Alveolar soft part sarcoma (ASPS) is an exquisitely rare sarcoma of unknown histogenesis, with a predilection for adolescents and young adults, characterized by slow progressive clinical course and ...high frequency of metastases. They are traditionally chemoresistant with very limited treatment options in the metastatic setting. Human cytomegalovirus (HCMV) is a DNA β-herpes virus and it is characterized by persistent lifelong and latent infection. There is growing evidence to indicate the presence of HCMV proteins and nucleic acids in glioblastoma, medulloblastoma, rhabdomyosarcoma, and a variety of solid organ malignancies of the breast, prostate, lung, and colon at very high prevalence. Immunotherapy-based clinical trials targeting specific cytomegalovirus proteins are currently in progress in the treatment of glioblastoma. Herein, we evaluated for the presence of HCMV proteins (IE1 and pp65), genes (US28 and UL96), and RNA in a cohort of ASPS. Six confirmed cases of ASPS were retrieved and full thickness sections of formalin-fixed paraffin-embedded material were stained for anti-HMCV-IE1 and anti-HCMV-pp65. Any nuclear and/or cytoplasmic staining was considered positive. DNA was purified from 50 µm of formalin-fixed paraffin-embedded material. One hundred nanogram of DNA was amplified using polymerase chain reaction for primers specific to HCMV-US28 (forward: AGCGTGCCGTGTACGTTAC and reverse: ATAAAGACAAGCACGACC) and HCMV-UL96 (forward: ACAGCTCTTAAAGGACGTGATGCG and reverse: ACCGTGTCCTTCAGCTCGGTTAAA) using Promega Taq polymerase. HCMV in situ hybridization was performed. All 6 cases of ASPS were positive for both HCMV-IE1 and HCMV-pp65. Usable DNA was available in 4 of the 6 cases. HCMV-US28 gene was found in 75% (3/4) of cases and HCMV-UL96 gene was detected in 50% (2/4) of cases. Importantly, all cases tested positive for at least 1 gene. HCMV-encoded RNA was identified in 80% (4/5) of cases. The presence of HCMV DNA, RNA along with HCMV protein indicates that HCMV is present in ASPS and may contribute to its pathogenesis.
Central nervous system cancers Brem, Steven S; Bierman, Philip J; Brem, Henry ...
Journal of the National Comprehensive Cancer Network
9, Številka:
4
Journal Article
Glioblastoma multiforme (GBM) is an aggressive brain cancer for which there is no effective treatment. Oncolytic HSV vectors (oHSVs) are attenuated lytic viruses that have shown promise in the ...treatment of human GBM models in animals, but their efficacy in early phase patient trials has been limited. Instead of attenuating the virus with mutations in virulence genes, we engineered four copies of the recognition sequence for miR-124 into the 3′UTR of the essential ICP4 gene to protect healthy tissue against lytic virus replication; miR-124 is expressed in neurons but not in glioblastoma cells. Following intracranial inoculation into nude mice, the miR-124-sensitive vector failed to replicate or show overt signs of pathogenesis. To address the concern that this safety feature may reduce oncolytic activity, we inserted the miR-124 response elements into an unattenuated, human receptor (EGFR/EGFRvIII)-specific HSV vector. We found that miR-124 sensitivity did not cause a loss of treatment efficiency in an orthotopic model of primary human GBM in nude mice. These results demonstrate that engineered miR-124 responsiveness can eliminate off-target replication by unattenuated oHSV without compromising oncolytic activity, thereby providing increased safety.
For clinical use of oncolytic HSV-1 (oHSVI), safety and therapeutic efficacy are essential. We have been employing an engineered oHSVI (rQNestin34.5, Kambara et al., Cancer Res., 2005) where the ...nestin promoter, highly expressed in glioblastoma stem-like cells (GSCs), drives expression of the viral ICP34.5 gene to enhance viral replication in GSCs with less toxicity to normal human cells. The c-terminus moiety of the viral ICP34.5 gene is necessary to initiate protein translation through dephosphorylation of the translation factor elF2alpha during viral infection but other moieties of ICP34other moieties of ICP34.5 lead to neurovirulence in the brain because they bind to beclin-1, leading to autophagy. To circumvent the possibility of neurovirulence by low-level expression of ICP34.5, we have now engineered a novel oHSVI vector, in which the nestin-promoter drives the cellular GADD34 (NG34) or a truncated GADD34 gene (NG34C). The rationale for this is that the C terminus of GADD34 dephosphorylates eiF2alpha, like ICP34.5, but does not produce neurovirulence since it does not possess the beclin-1 binding moiety. We found that those Delta ICP34.5 mutant HSV1 viruses, NG34 and NG34C are as efficacious as rQNestin34.5 against a panel of glioma cell lines and primary GBM cells. However, normal human primary cells did not support NG34C replication. We are currently evaluating neurovirulency of NG34 and NG34C in mouse brains. In summary, this newest generation of oHSV1s utilizes moieties from cellular genes that mimic those of viral genes required for efficient replication and lysis of gliomas without expressing viral gene moieties that are toxic to normal cells.
Abstract
The goal of this study is to evaluate SapC-DOPS, a novel cancer nanotherapeutic, for glioblastoma multiforme (GBM). SapC-DOPS delivered intravenously (i.v) was found to specifically target ...intracranial tumors in mice bearing spontaneous brain tumor, as well in nude mice intracranially implanted with human GBM cells. Treatment of tumor bearing mice with SapC-DOPS (i.v.) significantly increased survival: 25% and 75% long-term survivors in U87ΔEGFR-Luc and X12v2 implanted mice, respectively (P<.0001). Western blot analysis of primary GBM neurospheres treated with SapC-DOPS did not show activation of apoptosis as measured by cleaved caspase 9 and cleaved PARP, and lacked activation of DNA damage markers phosphor-ATM and γ-H2AX. Consistent with this, treatment with a pan-caspase inhibitor Z-VAD-FMK did not rescue SapC-DOPS-induced killing (P>0.05). In contrast, SapC-DOPS treatment increased levels of an autophagic marker LC3-II via western blot. Autophagosome formation was also confirmed through transmission electron microscopy. Utilizing a stable GBM cell line expressing a GFP-LC3 fusion protein, we observed punctuated GFP expression following treatment, indicative of autophagosome formation. Quantification of GFP punctated cells showed a significant increase in SapC-DOPS treated cells compared to control (P<.001). Analysis of red/green fluorescence following acridine orange staining showed an induction of acidic vesicular organelles indicative of autophagolysosomes. In addition, inhibition of autophagosome formation using 3-methyladeneine or inhibition of auotphagic vacuole maturation with bafilomycin A1 resulted in a significant rescue of SapC-DOPS-induced killing (P<.001). Knockdown of ATG5 using siRNA also resulted in a rescue of SapC-DOPS-induced cell death and autophagy induction (P<.001). Interestingly, we did not observe a decrease in the activation of mTOR as determined by the phosphorylation of 4EBP1 and p70S6K which are typically induced during autophagy. This led us to test the use of rapamycin, a known inhibitor of mTOR and inducer of autophagy, in combination with SapC-DOPS. By using the Chou Talalay analysis, we observed strong synergy for multiple drug combinations in primary GBM neurospheres (combination index < .4). To investigate whether SapC-DOPS induced autophagy could be preferentially targeting mitochondria (mitophagy), we utilized MitoTracker Green (mitochondria) and LysoTracker Red (autophagolysosomes). By using confocal microscopy analysis, we were able to observe a decrease in mitochondrial mass in cells treated with SapC-DOPS as well as co-localization of mitochondria with autophagolysosomes. In addition to this, we observed a significant decrease in ATP levels following SapC-DOPS treatment (P<.01). These findings suggest therapeutic implications for treating GBM by using SapC-DOPS alone and in combination with an AKT/mTOR inhibitor.
Citation Format: Jeffrey Wojton, Naduparambil K. Jacob, Nicholas Denton, Nina Dmitrieva, Hiroshi Nakashima, Chang-Hyuk Kwon, Lionel Chow, Ennio A. Chiocca, Arnab Chakravarti, Balveen Kaur, Xiaoyang Qi. SapC-DOPS induces lethal mitophagy in glioblastoma. abstract. In: Proceedings of the 104th Annual Meeting of the American Association for Cancer Research; 2013 Apr 6-10; Washington, DC. Philadelphia (PA): AACR; Cancer Res 2013;73(8 Suppl):Abstract nr 2169. doi:10.1158/1538-7445.AM2013-2169