Pelayanan Jaminan Kesehatan Nasional (JKN) menimbulkan problem medis dan yuridis bagi dokter di rumah sakit yang berpotensi melanggar disiplin profesi, etika dan hukum dan tidak memperoleh ...perlindungan hukum yang berkepastian. Masalah ini disebabkan karena kebijakan pelayanan JKN harus menyesuaikan dengan kebijakan pola tarif INA CBGs. Metode penelitian menggunakan pendekatan yuridis normatif, dengan data sekunder yang dianalisis secara kualitatif dengan metode kepustakaan. Hasil penelitian menunjukan (1) Pelaksanaan pelayanan medis berdasarkan ketentuan JKN menempatkan dokter pada situasi dilematis karena harus memberikan pelayanan berdasarkan clinical pathway yang alur tata klinisnya ditetapkan berdasarkan pola tariff INA CBGs. Kondisi ini membuat dokter sulit memperoleh hak untuk memberikan pelayanan medis menurut standar profesi dan standar prosedur operasional sebagaimana diatur dalam Pasal 50 huruf b dan mempersempit kesempatan dokter untuk menjalankan kewajiban memberikan pelayanan medis sesuai dengan standar profesi dan standar prosedur operasional serta kebutuhan medis pasien sesuai Pasal 51 huruf a Undang-Undang No 29 Tahun 2004 Tentang Praktik Kedokteran. Apabila dalam kasus tertentu dokter memberikan pelayanan tidak sesuai dengan alur klinis INA CBGs akan beresiko tidak mendapatkan jasa pembayaran/dikurangi jasa pembayarannya, karena pelayanan yang diberikan melebihi pagu tarif yang telah ditetapkan dapat beresiko merugikan rumah sakit. (2) Kebijakan perlindungan hukum bagi dokter di rumah sakit yang menjalankan pelayanan JKN untuk menciptakan rasa aman dan ketertiban dalam pelayanan medis adalah: (a) Kebijakan perlindungan hukum yang bersifat preventif berupa pembuatan PNPK tatalaksana yang sudah disesuaikan dengan kebijakan pola taif INA CBGs dan pembuatan SPM sesuai dengan tipologi rumah sakit (A,B,C), karena saat ini pola tarif INA CBGs yang sudah dibuat oleh National Casemix Centre (NCC) berdasarkan dignosa penyakit dalam kelompok INA DRG berbasis pada SPM. (b) Kebijakan perlindungan hukum terhadap dokter di rumah sakit dalam melakanakan pelayanan medis sesuai ketentuan JKN adalah dengan mengadakan upaya mediasi oleh MKDKI secara independen dan otonom agar menilai tuntutan hukum yang diajukan pasien atau keluarganya. Upaya mediasi dilaksanakan untuk menghindari tuntutan hukum malpraktik kepada dokter kecuali apabila mediasi tidak mencapai kesepakatan maka pasien atau keluarganya dapat mengajukan tuntutan pidana atau gugatan perdata ke pengadilan.
In this Article the author considers the features observed in the course of valuation of special purpose real estate, i.e., the data processing centers (DPCs) and the data processing and storage ...centers (DPSCs) in accordance with experience accumulated by the international community and based on the recommendations contained in the International Valuation Standards as well as the RICS methodological guidelines (The Royal Institution of Chartered Surveyors (Great Britain)). The present article is justified as currently Russia lacks a separate and uniform for all valuers or forensic experts standard or methodological recommendations in the sphere of valuation of the data processing centers and courseware is scarce. At the same time Russia, similar to other countries of the world, is witnessing a considerable growth of construction of the DPCs later involved in the stream of commerce as transacted, subject to mortgage or disputed properties. The present article analyzes the modern approach internationally applied to value the DPCs, summarizes the author’s personal professional experience in this sphere. At the same time the author determines and provides a deep insight into the specifics of the target group or real estate, identifies and classifies its key merits which exert effect on the properties’ value. The author provides a deep insight into applying the valuation approaches and methods, together with practical recommendations as to how measure market value within the frameworks of the cost, market or income approaches. The author gives special focus to the key (income) approach, describes the details of the types of the services which are capable of forming income from DPC operating activities, examines the items of DPC operating costs and provides practical guidelines to be applied to measure the cap rate of this type of real estate.
From 1937 until 1999, West Nile virus (WNV) garnered scant medical attention as the cause of febrile illness and sporadic encephalitis in parts of Africa, Asia, and Europe. After the surprising ...detection of WNV in New York City in 1999, the virus has spread dramatically westward across the United States, southward into Central America and the Caribbean, and northward into Canada, resulting in the largest epidemics of neuroinvasive WNV disease ever reported. From 1999 to 2004, >7,000 neuroinvasive WNV disease cases were reported in the United States. In 2002, WNV transmission through blood transfusion and organ transplantation was described for the first time, intrauterine transmission was first documented, and possible transmission through breastfeeding was reported. This review highlights new information regarding the epidemiology and dynamics of WNV transmission, providing a new platform for further research into preventing and controlling WNV disease.
Celotno besedilo
Dostopno za:
DOBA, IZUM, KILJ, NUK, ODKLJ, PILJ, PNG, SAZU, SIK, UILJ, UKNU, UL, UM, UPUK
The article reveals the problem of developing the humanistic qualities of the teacher in the process of organizing interactive education in primary school. The professional and personal qualities ...which characterize a humane primary school teacher are defined. It is emphasized that special attention is paid to the organization of the educational process as effective multilateral communication. Applying one or another technology, in our case interactive, to solve the tasks of the educational process, the primary school teacher will definitely use appropriate teaching methods. That is, the implementation of training using certain technologies occurs primarily through a system of adequate methods, which are the core of this technology. The role of "active" and "passive" learning methods, when students act as the "object" of teachning, is analyzed. It is noted that interactive teaching methods provide the greatest space for self-realization of the student in learning and most closely correspond to a person-oriented approach. They are focused on the realization of the cognitive interests and needs of the individual, therefore special attention is paid to the organization of the process of effective multilateral communication, which is characterized by the absence of polarity and minimal concentration on the teacher's point of view. Participants of such communication are more mobile, open and active. Therefore, the key to understanding the role of interactive communication in the social development of a child, both a child and a teacher, is the thesis that a child's personality develops in unity, communication with the nearest micro-society, which includes peers and teachers. In addition, the use of interactive methods ensures the implementation of the idea of cooperation in the team, contributes to the improvement of the psychological climate in the classroom, and creates an atmosphere of goodwill during training. The study of the role of the organization of interactive learning in the development of humanistic qualities of primary school teachers was organized in the following directions: self-analysis of their personal and professional qualities and determination of the importance of interactive learning in the formation of humanistic qualities. It is noted that a special role in the development of the teacher's humanistic qualities in the process of organizing interactive learning is played by their readiness for professional activity
The aim of the study was to incorporate a multidimensional approach to the biodeteriorative influence of aerophytic algal biofilms colonising building materials, such as bricks and plasters in ...temperature climate zones. Stichococcus sp., Klebsormidium sp., Chlorococcum infusionum, Chlorella vulgaris and Pseudochlorella signiensis were detected in green biofilms covering internal and external walls of buildings in Poland. Their growth led to changes in the material's colour in the range of ΔE = 10.82–37.67, as well high water retention and absorptivity. The moisture content of analysed materials ranged from 9.00 to 14.59%. Further, the direct influence of algal growth on the mechanical properties of the analysed materials was not found. For metabolome analysis laser desorption/ionisation time-of-flight mass spectrometry with silver-109 and gold nanoparticles was used. Derivatives of sulfuric compounds and organic acids were detected but this was not the case for metabolites with well-documented biodeteriorative potential. 109AgNPET LDI MS allowed for the detection of 43 different metabolic pathways, using AuNPET LDI MS 25 pathways. In total, 110 metabolites were found. Although the spectrum of metabolites detected using 109AgNPET LDI MS was broader, AuNPET LDI MS allowed for the detection of pathways that were not found by 109AgNPET LDI MS. The combination of both methods allowed for the widest range of results.
•Only green algae grew on facades and more diverse were samples from interior walls.•Algal biofilms caused visible aesthetical biodeterioration ΔE>10.•Higher biomass of algae corresponded to greater moisture of building materials.•Metabolome assays confirmed presence of algal metabolites in samples.•109Ag- and Au NPET LDI MS complement each other giving broadest metabolome profiles.
Cognitive training techniques such as motor imagery (MI)-cognitive simulation of movement, has been found to successfully facilitate skill acquisition. The MI literature emphasizes the need to ...accurately imitate key elements of motor execution to facilitate improved performance outcomes. However, there is a scarcity of MI research investigating how contemporary approaches to motor learning, such as nonlinear pedagogy (NLP), can be integrated into MI practice. Grounded in an ecological dynamics approach to human movement, NLP proposes that skilled action is an emergent process that results from continuous interactions between perceptual information of the environment and movement. This emergent process can be facilitated by the manipulation of key task constraints that aim to encourage learners to explore movement solutions that satisfy individual constraints (e.g., height and weight) and achieve successful performance outcomes. The aim of the present study was to explore the application of a NLP approach to MI approach for skill acquisition. Fourteen weightlifting beginners (two female and 12 male) participated in a 4-week intervention involving either NLP (i.e. analogy-based instructions and manipulation of task constraints) or a linear pedagogy (LP; prescriptive instructions of optimal technique, repetition of same movement form) to learn a complex weightlifting derivative. Performance accuracy, movement criterion (barbell trajectory type), kinematic data, and quantity of exploration/exploitation were measured pre-mid-post intervention. No significant differences (p = .438) were observed in the amount of exploration between LP (EER = 0.41) and NLP (EER = 0.26) conditions. Equivalent changes in rearward displacement (RxD) were observed with no significant differences between conditions for technique assessments 1, 2, or 3 (p = .13 - .67). Both NLP and LP conditions were found to primarily demonstrate 'sub-optimal' type 3 barbell trajectories (NLP = 72%; LP = 54%). These results suggest that MI instructions prescribing a specific movement form (i.e., LP condition) are ineffective in restricting available movements to a prescribed technique but rather the inherent task constraints appear to 'force' learners to explore alternative movement solutions to achieve successful performance outcomes. Although MI instructions prescribing specific techniques have previously supported improved skill development, the current findings indicate that learners may self-organise their movements regardless of MI instructions to satisfy individual and task constraints while achieving improved performance. Therefore, it may be beneficial to consider scripts that are more outcome focused and incorporate task constraints to facilitate learners' inherent exploration of individual task solutions.
Celotno besedilo
Dostopno za:
DOBA, IZUM, KILJ, NUK, PILJ, PNG, SAZU, SIK, UILJ, UKNU, UL, UM, UPUK
The ability of animals to produce endogenous heat provides a buffer against environmental changes but also incurs high energetic costs. Especially small endothermic mammals have high energy demands. ...Some temperate-zone species (heterotherms) regularly use torpor, which slows down their entire metabolism but also potentially delays reproduction, to compensate for this. We used a unique experimental approach to test the consequences of extended low and high ambient temperatures on the trade-off in energy allocation to body mass maintenance, thermoregulation effort and seasonal sexual maturation in temperate zone male bats. We showed that long exposure to low ambient temperature shifts energy allocation away from sexual maturation to self-maintenance and results in a delay of sperm maturation by as much as an entire month. This effect was partially buffered by higher body mass. Heavier bats were able to afford more intensive thermoregulation and consequently speed up maturation. Interestingly, bats at constant high temperatures avoided deep torpor and matured faster than those at low temperatures, but sperm production was also slower than under natural conditions. Our results show that not only low, but also constant high ambient temperatures are detrimental during seasonal sexual maturation and the trade-off between investing into self-maintenance and fitness is a finely tuned compromise.
Grapevine fanleaf virus (GFLV) is the main causal agent of fanleaf degeneration, the most damaging viral disease of grapevine. GFLV is included in most grapevine certification programs that rely on ...robust diagnostic tools such as biological indexing, serological methods, and molecular techniques, for the identification of clean stocks. The emergence of high throughput sequencing (HTS) offers new opportunities for detecting GFLV and other viruses in grapevine accessions of interest. Here, two HTS-based methods,
, RNAseq and smallRNAseq (focusing on the 21 to 27 nt) were explored for their potential to characterize the virome of grapevine samples from two 30-year-old GFLV-infected vineyards in the Champagne region of France. smallrnaseq was optimal for the detection of a wide range of viral species within a sample and RNAseq was the method of choice for full-length viral genome assembly. The implementation of a protocol to discriminate between low GFLV titer and
contamination (intra-lane contamination due to index misassignment) during data processing was critical for data analyses. Furthermore, we compared the performance of semi-quantitative DAS-ELISA (double antibody enzyme-linked immunosorbent assay), RT-qPCR (Reverse transcription-quantitative polymerase chain reaction), Immuno capture (IC)-RT-PCR, northern blot for viral small interfering RNA (vsiRNA) detection and RNAseq for the detection and quantification of GFLV. While detection limits were variable among methods, as expected, GFLV diagnosis was consistently achieved with all of these diagnostic methods. Together, this work highlights the robustness of DAS-ELISA, the current method routinely used in the French grapevine certification program, for the detection of GFLV and offers perspectives on the potential of HTS as an approach of high interest for certification.
Grapevine enamovirus 1 (GEV-1) is a member of the genus Enamovirus in the family Solemoviridae. GEV-1 was first described in 2017 in a few grapevine cultivars in Brazil (Silva et al. 2017) and ...subsequently in China (Ren et al. 2021). We first identified GEV-1 using high throughput sequencing (Illumina, NOVASeq SP, TruSeq mRNA stranded 2*150 bp) of ribosomal RNA depleted total RNAs extracts using RNeasy Plant mini kit) (Qiagen) from a Vitis vinifera 'Meunier' leaf sample collected in a more than 20 year old commercial vineyard in the Champagne region of France in 2019. Analyses of the 47,573,330 total reads were performed using CLC Genomics Workbench 12.0 software (Qiagen) as previously described (Hily et al. 2018). The GEV-1 genome, determined only from the HTS data (isolate GEV-1-Fr; GenBank accession No. MW760844), is 6 262 nucleotides (nt) long and fully covered with 5,706 reads (mapping parameters of 0,5 in length and 0,7 in similarity fractions using CLC). Compared with the previously determined sequences (NC_034836 and KX645875) from Brazil, the GEV-1-Fr sequence contain a few indels, including a deletion of 9 nt in the 5' untranslated region (UTR), an insertion of 3 nt located in the overlapping region of the open reading frame (ORF)1 and ORF2, and a single nt insertion in the non-coding region between ORF2 and ORF3. These indels also exist within the sequence of isolate SD-CG from China (MT536978). However, GEV-1-Fr contains a unique 45 nt insertion in the 3'-UTR, although this needs to be verified using standard assays. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity at the nt level with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. The GEV-1-infected 'Meunier' grapevine showed symptoms of light chlorotic patterns on the leaves that were probably due to the presence of other co-infecting viruses, including Grapevine fanleaf virus, Grapevine Pinot gris virus, Grapevine rupestris stem pitting-associated virus and Grapevine fleck virus. The detection of GEV-1 was further confirmed in the 'Meunier' grapevine via RT-PCR using newly designed primer pairs Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT and Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG that amplified a 474 bp fragment of ORF5. We also designed a TaqManTM assay in OFR5 with the following primers and probe; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG, Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC, Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original 'Meunier' plant from Champagne was positive for GEV-1. To our knowledge, this is the first report of GEV-1 in France and in European vineyards in general. Although many aspects of the virus biology are yet to be elucidated, our results expand its geographical range. New GEV-1 detection primers can be developed, considering its genetic diversity, to facilitate its detection and further define its evolutionary history. Compared to the original sequences (NC_034836 and KX645875) in Brazil a few indels have been identified, including a deletion of 9nt located in the 5' untranslated region (UTR), an insertion of 3nt located in the overlapping region of the open reading frame (ORF)1 and ORF2 and a single nucleotide insertion in the non-coding region between ORF2 and ORF3. All indels were already described in the Chinese sequence (MT536978). However, this new GEV-1-Fr isolate is the only one that displays a 45nt insertion in the 3'-UTR. Overall, GEV-1-Fr exhibits 88.7, 89.1 and 93.3 % identity with isolates from Brazil (NC_034836, KX645875) and China (MT536978), respectively. No specific symptoms were observed in the GEV-1-infected 'Meunier' grapevine other than light chlorotic patterns on the leaves that were probably due to the presence of other virus, as this plant was co-infected with grapevine fanleaf virus (GFLV), grapevine Pinot gris virus (GPGV), grapevine rupestris stem pitting-associated virus (GRSPaV) and grapevine fleck virus (GFkV). The detection of GEV-1 was further confirmed via RT-PCR using newly designed primer pairs located in the 'aphid transmission protein' producing a 474 nt amplicon; Fwd_GEV_5600: GCAAGGAGCAGCCCTATAATGCT; Rev_GEV_6075: CTAGTCGATACGATCTATAGGCGAGG. GEV-1 was detected in all cuttings (N=15) obtained from the original plant. We also designed a tool for a TaqManTM-based detection in the same genome region as mentioned above; Fwd_GEV_5662: ACAAGTGCCYGTTTCCATAG; Probe_GEV_5724-FAM: TTTACCGAGGACTATGACGCCGC; Rev_GEV_5772: CACCGGCTCCATAACCATT. Among all the samples from different grapevine cultivars and geographic regions in France that were tested with the TaqMan assay (N=188), only the original 'Meunier' plant from Champagne was found positive for GEV-1 in gapevine in France.
Capturing flue gases often require multiple stages of scrubbing, increasing the capital and operating costs. So far, no attempt has been made to study the absorption characteristics of all the three ...gases (NO, SO
and CO
) in a single stage absorption unit at alkaline pH conditions. We have attempted to capture all the three gases with a single wet scrubbing column. The absorption of all three gases with sodium carbonate solution promoted with oxidizers was investigated in a tall absorption column. The absorbance was found to be 100% for CO
, 30% for NO and 95% for SO
respectively. The capture efficiency of sodium carbonate solution was increased by 40% for CO
loading, with the addition of oxidizer. Absorption kinetics and reaction pathways of all the three gases were discussed individually in detail.
PDF
