Global warming and climate change intensified the occurrence and severity of abiotic stresses that seriously affect the growth and development of plants,especially, plant photosynthesis. The direct ...impact of abiotic stress on the activity of photosynthesis is disruption of all photosynthesis components such as photosystem I and II, electron transport, carbon fixation, ATP generating system and stomatal conductance. The photosynthetic system of plants reacts to the stress differently, according to the plant type, photosynthetic systems (C₃ or C₄), type of the stress, time and duration of the occurrence and several other factors. The plant responds to the stresses by a coordinate chloroplast and nuclear gene expression. Chloroplast, thylakoid membrane, and nucleus are the main targets of regulated proteins and metabolites associated with photosynthetic pathways. Rapid responses of plant cell metabolism and adaptation to photosynthetic machinery are key factors for survival of plants in a fluctuating environment. This review gives a comprehensive view of photosynthesis-related alterations at the gene and protein levels for plant adaptation or reaction in response to abiotic stress.
Background Plant roots are important organs to uptake soil water and nutrients, perceiving and transducing of soil water deficit signals to shoot. The current knowledge of drought stress ...transcriptomes in rice are mostly relying on comparative studies of diverse genetic background under drought. A more reliable approach is to use near-isogenic lines (NILs) with a common genetic background but contrasting levels of resistance to drought stress under initial exposure to water deficit. Here, we examined two pairs of NILs in IR64 background with contrasting drought tolerance. We obtained gene expression profile in roots of rice NILs under different levels of drought stress help to identify genes and mechanisms involved in drought stress. Results Global gene expression analysis showed that about 55% of genes differentially expressed in roots of rice in response to drought stress treatments. The number of differentially expressed genes (DEGs) increased in NILs as the level of water deficits, increased from mild to severe condition, suggesting that more genes were affected by increasing drought stress. Gene onthology (GO) test and biological pathway analysis indicated that activated genes in the drought tolerant NILs IR77298-14-1-2-B-10 and IR77298-5-6-B-18 were mostly involved in secondary metabolism, amino acid metabolism, response to stimulus, defence response, transcription and signal transduction, and down-regulated genes were involved in photosynthesis and cell wall growth. We also observed gibberellic acid (GA) and auxin crosstalk modulating lateral root formation in the tolerant NILs. Conclusions Transcriptome analysis on two pairs of NILs with a common genetic background (approximately 97%) showed distinctive differences in gene expression profiles and could be effective to unravel genes involved in drought tolerance. In comparison with the moderately tolerant NIL IR77298-5-6-B-18 and other susceptible NILs, the tolerant NIL IR77298-14-1-2-B-10 showed a greater number of DEGs for cell growth, hormone biosynthesis, cellular transports, amino acid metabolism, signalling, transcription factors and carbohydrate metabolism in response to drought stress treatments. Thus, different mechanisms are achieving tolerance in the two tolerant lines.
Celotno besedilo
Dostopno za:
DOBA, IZUM, KILJ, NUK, PILJ, PNG, SAZU, SIK, UILJ, UKNU, UL, UM, UPUK
Rice (Oryza sativa L.) is a highly drought sensitive crop, and most semi dwarf rice varieties suffer severe yield losses from reproductive stage drought stress. The genetic complexity of drought ...tolerance has deterred the identification of agronomically relevant quantitative trait loci (QTL) that can be deployed to improve rice yield under drought in rice. Convergent evidence from physiological characterization, genetic mapping, and multi-location field evaluation was used to address this challenge.
Two pairs of backcross inbred lines (BILs) from a cross between drought-tolerant donor Aday Sel and high-yielding but drought-susceptible rice variety IR64 were produced. From six BC4F3 mapping populations produced by crossing the +QTL BILs with the -QTL BILs and IR64, four major-effect QTL--one each on chromosomes 2, 4, 9, and 10--were identified. Meta-analysis of transcriptome data from the +QTL/-QTL BILs identified differentially expressed genes (DEGs) significantly associated with QTL on chromosomes 2, 4, 9, and 10. Physiological characterization of BILs showed increased water uptake ability under drought. The enrichment of DEGs associated with root traits points to differential regulation of root development and function as contributing to drought tolerance in these BILs. BC4F3-derived lines with the QTL conferred yield advantages of 528 to 1875 kg ha⁻¹ over IR64 under reproductive-stage drought stress in the targeted ecosystems of South Asia.
Given the importance of rice in daily food consumption and the popularity of IR64, the BC4F3 lines with multiple QTL could provide higher livelihood security to farmers in drought-prone environments. Candidate genes were shortlisted for further characterization to confirm their role in drought tolerance. Differential yield advantages of different combinations of the four QTL reported here indicate that future research should include optimizing QTL combinations in different genetic backgrounds to maximize yield advantage under drought.
Celotno besedilo
Dostopno za:
DOBA, IZUM, KILJ, NUK, PILJ, PNG, SAZU, SIK, UILJ, UKNU, UL, UM, UPUK
A mapping population consisting of 236 F2:3 families derived from the cross between two rice varieties, Gharib as female parent (with good cooking quality) and Sepidroud as male parent (with poor ...cooking quality) was used to analyze the quantitative trait loci (QTLs) associated with amylose content (AC), gelatinisation temperature (GT) and gel consistency (GC). A total of 105 single sequence repeat (SSR) markers were used to construct a genetic linkage map, covering a total length of 1440.7 cM of the genome in rice (Oryza sativa L.) with an average distance of 13.72 cM between markers. Twelve independent QTLs were identified using composite interval mapping. These loci consisted of three QTLs for GT, eight QTLs for AC and one QTL for GC, most of which are reported here for the first time. For GT the QTL explaining the largest proportion of variance (18.4%) was located on chromosome 6, the same locus as the alkali degeneration gene (alk). For AC, four QTLs were found on chromosome 6, one of which was located at the interval RM586-RM190 explaining 19.3% of the total variation and which should coincide with the waxy region (wx) located on the short arm of this chromosome. The results using Iranian rice cultivars, in combination with previous reports further confirmed that alk and wx regions play a considerable role in determining cooking and eating quality of rice.
Background
Rice crop may experience a significant reduction in yield—up to 50%—due to two occurrences during drought stress: unsuccessful peduncle elongation in panicle exertion and ineffective grain ...filling. The comprehension of mechanisms that promote drought tolerance during these growth phases is crucial for the production of rice that can withstand drought conditions, thus averting a decrease in crop yield.
Methods and results
The expression of two xyloglucan endo transhydrolase/glucosylase genes (
OsXTH
5 and 19) in peduncle tissue and a sucrose transporter gene (
OsSUT1
) in flag leaf sheath were assessed. An experiment was carried out in a factorial arrangement based on completely randomized design in which, factor A was two rice cultivars (Vandana as tolerant and Tarom mahalli as local susceptible to drought) and factor B was five drought stress treatments (full irrigation, drought stress duration in 72 and 96 h, re-watering after 120 and 192 h). Results showed that expression of
OsXTH19
and
OsXTH5
genes were upregulated in both Vandana and Tarom mahalli cultivars due to stress treatments.
OsXTH19
expression was found to decrease while
OsXTH5
expression increased during re-watering treatments. It is likely that the persistence of peduncle growth in the drought-tolerant Vandana cultivar can be attributed to the presence of
OsXTH19
under drought conditions and
OsXTH5
after re-watering. The expression of
OsSUT1
in flag leaf sheath of Vandana in re-watering treatments was reached 8-60-fold re-watering.
Conclusions
Peduncle elongation was attributed to two
XTH
genes under drought stress condition. Panicle exertion may be promoted by sustaining peduncle growth despite drought stress. Consequently, this may led to reduce in non fertile florets and decrease in grain yield by 50%. As grain filling depend to expression of
OsSUT1
in flag leaf sheath under drought stress, to improve rice cultivars under aerobic production system and drought stress, it is advised to apply these findings in rice breeding programs.
Blast disease is a notorious fungal disease leading to dramatic yield losses on major food crops such as rice and wheat. The causal agent,
, encompasses different lineages, each having a different ...host range. Host shifts are suspected to have occurred in this species from
spp. to rice and from
spp. to wheat. The emergence of blast disease on maize in Iran was observed for the first time in the north of the country in 2012. We later identified blast disease in two additional regions of Iran: Gilan in 2013 and Golestan in 2016. Epidemics on the weed barnyard grass (
spp.) were also observed in the same maize fields. Here, we showed that
is the causal agent of this disease on both hosts. Pathogenicity assays in the greenhouse revealed that strains from maize can infect barnyard grass and conversely. However, genotyping with simple sequence repeat markers and comparative genomics showed that strains causing field epidemics on maize and on barnyard grass are different, although they belong to the same previously undescribed clade of
. Phylogenetic analyses including these strains and a maize strain collected in Gabon in 1985 revealed two independent host-range expansion events from barnyard grass to maize. Comparative genomics between maize and barnyard grass strains revealed the presence or absence of five candidate genes associated with host specificity on maize, with the deletion of a small genomic region possibly responsible for adaptation to maize. This recent emergence of
on maize provides a case study to understand host range expansion. Epidemics on maize raise concerns about potential yield losses on this crop in Iran and potential geographic expansion of the disease.
Drought tolerance is a complex quantitative trait that involves the coordination of a vast array of genes belonging to different pathways. To identify genes related to the drought-tolerance pathway ...in rice, we carried out gene-expression profiling of the leaves of near-isogenic lines (NILs) with similar genetic backgrounds and different set of QTLs but contrasting drought tolerance levels in response to long-term drought-stress treatments. This work will help differentiate mechanisms of tolerance in contrasting NILs and accelerate molecular breeding programs to improve drought tolerance in this crop.
The two pairs of rice NILs, developed at the International Rice Research Institute, along with the drought-susceptible parent, IR64, showed distinct gene-expression profiles in leaves under different water-deficit (WD) treatments. Drought tolerance in the highly drought-tolerant NIL (DTN), IR77298-14-1-2-B-10, could be attributed to the up-regulation of genes with calcium ion binding, transferase, hydrolase and transcription factor activities, whereas in the moderate DTN, IR77298-5-6-B-18, genes with transporter, catalytic and structural molecule activities were up-regulated under WD. In IR77298-14-1-2-B-10, the induced genes were characterized by the presence of regulatory motifs in their promoters, including TGGTTAGTACC and (CTAACGTG){2}, which are specific to the TFIIIA and Myb transcription factors, respectively. In IR77298-5-6-B-18, promoters containing a GCACAGACGTATTCCCAGAACGTGCT motif, common to MADS(AP1), HD-ZIP, AP2 and YABBY, were induced, suggesting that these factors may play key roles in the regulation of drought tolerance in these two DTNs under severe WD.
We report here that the two pairs of NILs with different levels of drought tolerance may elucidate potential mechanisms and pathways through transcriptome data from leaf tissue. The present study serves as a resource for marker discovery and provides detailed insight into the gene-expression profiles of rice leaves, including the main functional categories of drought-responsive genes and the genes that are involved in drought-tolerance mechanisms, to help breeders identify candidate genes (both up- and down-regulated) associated with drought tolerance and suitable targets for manipulating the drought-tolerance trait in rice.
Celotno besedilo
Dostopno za:
DOBA, IZUM, KILJ, NUK, PILJ, PNG, SAZU, SIK, UILJ, UKNU, UL, UM, UPUK
The NAC (NAM, ATAF1/2 and CUC2) genes are plant-specific transcriptional factors known to play diverse roles in various plant developmental processes. We describe the rice (Oryza sativa) OsNAC genes ...expression profiles (GEPs) under normal and water-deficit treatments (WDTs). The GEPs of the OsNAC genes were analyzed in 25 tissues covering the entire life cycle of Minghui 63. High expression levels of 17 genes were demonstrated in certain tissues under normal conditions suggesting that these genes may play important roles in specific organs. We determined that 16 genes were differentially expressed under at least 1 phytohormone (NAA, GA3, KT, SA, ABA, and JA) treatment. To investigate the GEPs in the root, leaf, and panicle of three rice genotypes e.g., 2 near-isogenic lines (NILs) and IR64, we used two NILs from a common genetic combination backcross developed by Aday Selection and IR64. WDTs were applied using the fraction of transpirable soil water at severe, mild, and control conditions. Transcriptomic analysis using a 44K oligoarray from Agilent was performed on all the tissue samples. We identified common and specific genes in all tissues from the two NILs under both WDTs, and the majority of the OsNAC genes that were activated were in the drought-tolerant IR77298-14-1-2-B-10 line compared with the drought-susceptible IR77298-14-1-2-B-13 or IR64. In IR77298-14-1-2-B-10, seventeen genes were very specific in their expression levels. Approximately 70 % of the genes from subgroups SNAC and NAM/CUC3 were activated in the leaf, but 37 % genes from subgroup SND were inactivated in the root compared with the control under severe stress conditions. These results provide a useful reference for the cloning of candidate genes from the specific subgroup for further functional analysis.
As a prerequisite to improving diseaseresistance and grain quality in Iranianrice cultivars, we determined the geneticrelatedness of popular local cultivars andblast-resistance donor germplasm ...usingfingerprints derived from simple sequencerepeat (SSR) and plant defense genemarkers. Fifty SSR markers and 28 defensecandidate genes were used to assess thegenetic diversity among popular ricecultivars from Iran and donors of blastresistance from breeding programs in Asia.Gene diversity estimate of the 16 corebreeding lines was 0.440 ± 0.028 basedon SSR markers. Genetic relationships amongthe cultivars were determined by clusteranalysis using SSR and candidate genedatasets. DNA fingerprints derived fromSSR and defense gene markers gave similargroupings of cultivars consistent withtheir genetic background: a) Iranian localvarieties, b) improved varieties in Iranplus donor indica germplasm from Asia, andc) japonica germplasm. Within-groupsimilarities for the traditional andimproved cultivars were greater than 80%and 75%, respectively. The traditional andimproved cultivars showed differentialreaction to blast pathogen isolates; alltraditional varieties were susceptible toblast pathogen isolates in Iran butresistant to isolates in the Philippines,whereas the improved varieties showedopposite reaction to pathogen isolates inIran and the Philippines. Both molecularand phenotypic data suggest a narrowgenetic basis in local and improvedcultivars in Iran and the need forincluding more diversity for the breedingprogram. The high degree of polymorphismobserved between local cultivars and donorsof blast resistance provide the neededinformation to follow the transmission ofresistance alleles from the donors inadvancing breeding lines.PUBLICATION ABSTRACT
PDF
