•All ESBL-producing E. coli isolates harboured the ESBL blaCTX-M-15 gene.•Cefoxitin-nonsusceptible isolates had alterations in porins and regulatory genes.•Class 1 integrons were detected on ESBL ...gene-carrying plasmids.•Co-located resistance genes may facilitate the dissemination of ESBL genes.
A total of 405 Escherichia coli from the chicken production chains in Nigeria were investigated for ESBL-production and 4 isolates were identified as ESBL producers. They were characterized by XbaI-PFGE, multilocus sequence typing (MLST), phylotyping, sequencing of porin and regulatory genes and of the regulatory region of chromosomal ampC genes. Transformed ESBL gene-carrying plasmids were characterized by S1-nuclease, replicon typing, conjugation, digestion and PCRs for detection of the genetic environment of ESBL genes. Susceptibility testing, PCRs for the resistance genes, integrons, and the DNA microarray were performed with both, the original isolates and the transformants. All ESBL-producing isolates harboured blaCTX-M-15 genes located on non-conjugative plasmids (120–155kb). Three isolates with closely related/indistinguishable XbaI-patterns belonged to phylogroup A, and MLST sequence type ST10 and the fourth to phylogroup D and ST405. Resistance to aminoglycosides, sulfonamides/trimethoprim, quinolones, and tetracyclines were seen in all isolates. Incompatibility group IncFIB blaCTX-M-15-carrying plasmids were detected in the three related isolates which carried also a class 1 integron (aadA2-orfF-dfrA12) and the resistance genes blaOXA-1, blaTEM-1, aac(3′)-IIa, aac(6′)-Ib-cr, sul1, sul2, and tet(A). The IncFIA-IncFIB-IncI1 blaCTX-M-15-carrying plasmid harboured additionally the resistance genes aac(3′)-IIa and tet(B). The blaCTX-M-15 genes were associated with ISEcp1 and Δorf477. ESBL-producing isolates showed elevated MICs to cefoxitin (16–64mg/L) and ertapenem MICs (0.5–2.0mg/L) mainly due to alterations in the porin genes. The virulence genes astA and prfB were detected. Although a low prevalence of ESBL-producing isolates was found, co-located resistance genes on the ESBL gene-carrying plasmids may facilitate the dissemination of them.
Aim
This study aimed to investigate the isolation rate, antibiotic resistance and virulence genes of Salmonella enterica serovar from two commercial farms in Nigeria.
Methods and Results
Salmonella ...isolation was performed according to the United States Food and Drug Agency (USFDA) method. Serotyping, antimicrobial susceptibility testing, detection of resistance and virulence genes were done using the Kauffman–White Scheme, disc diffusion, minimum inhibitory concentration and real‐time polymerase chain reaction techniques. Salmonella serovars were isolated from only farm A at 22/50 (44.0%) while none were isolated from farm B. Salmonella Typhi, 9 (40.9%); Salmonella Typhimurium, 2 (9.1%), Salmonella Enteritidis, 2 (9.1%), Salmonella Pullorum, 1 (4.5%), Salmonella Kentucky, 4 (18.2%) were identified while 4 (18.2%) were untypable. Sixteen isolates (72.7%) showed multiple drug resistance and 17 different resistance profile types with AMP‐CHL‐TRM‐SXT as the most prevalent pattern. Resistance genes (blaTEM, 12/22 (54.5%) and virulence genes (InvA, sopB, mgtC and spi4D, 22/22 (100.0%), ssaQ, 16/22 (72.7%) and spvC, 13/22 (59.1%) were found, while blaSHV, blaCTX‐M, floR, tetA, tetB, tetG and LJSGI‐1 genes were absent.
Conclusion
Pathogenic Salmonella were isolated from the chicken droppings in this study. Most of these strains were resistant to antibiotics and possessed characteristics of virulence.
Significance and Impact of the Study
Chicken droppings from this study area contained pathogenic strains of Salmonella and a rare occurrence of Salmonella Typhi. The study revealed that the environment and the food chain could be at risk of contamination of highly virulent and antimicrobial‐resistant strains of Salmonella. These could affect the profitability of the poultry industry and food consumption. There is a need for caution in indiscriminate disposal of poultry waste and the use of uncomposted chicken droppings in soil amendment.
•Household non-prescriptional antimicrobial usage was common in humans and animals.•ESBL-producing bacteria were found in animals, human, food and environmental sources.•ESBL-gene variant included ...blaCTX-M-15, blaCTX-M-14, blaCTX-M-27 and blaCTX-M-55.•ESBL-producing bacteria included Escherichia coli and Klebsiella pneumoniae.•All ESBL-producing isolates showed multidrug resistance.
This study examined socioeconomic and cultural factors relating to animal husbandry, antimicrobial usage and household hygiene in 320 animal-keeping households of 16 rural and peri-urban communities of Ogun State, Nigeria. The occurrence of extended-spectrum β-lactamase-producing Enterobacteriaceae in 457 samples from animal and environmental sources within the households was investigated. Chickens (41.6%), goats (35.3%), dogs (33.8%) and sheep (14.4%) were the most common household animals. Animals were reared mainly for income generation (73.9%) and for household consumption (18.3%). They were reared predominantly (60.2%–100%) under the extensive system with unrestricted access to human space, cooking utensils and foods. Households were assessed as having good (59.4%), fair (22.2%) and poor (18.4%) hygiene. The rate of household non-prescriptional antimicrobial usage was 69.4% in humans and 60.6% in animals. Overall, ESBL-producing Enterobacteriaceae were detected in 53 (11.6%) of 457 samples. The ESBL-producing isolates were identified as Escherichia coli (n = 49) and Klebsiella pneumoniae (n = 4). They harboured the ESBL gene variants blaCTX-M-15 (n = 49), blaCTX-M-14 (n = 2), blaCTX-M-27 (n = 1) or blaCTX-M-55 (n = 1). Forty-eight ESBL-producing E. coli were assigned into phylogenetic groups A (n = 17), B1 (n = 14), D (n = 13) and F (n = 4). All ESBL-producing isolates demonstrated multidrug resistance to antimicrobial agents belonging to at least three different classes of antimicrobials. Poor regulation of antimicrobial marketing and inadequate access to veterinary care contributed to non-prescriptional use of antimicrobials in humans and animals. Free-range household animals harboured ESBL-producing bacteria and may facilitate the dispersal of the organisms within the community.
There is paucity of information on the prevalence of leptospirosis in wildlife in Nigeria. This study investigated the prevalence and renal pathology of leptospirosis in wild animals in Southwest ...Nigeria. One hundred and five kidney samples were examined from 10 different wildlife species (antelope) greater cane rat (GCR), hare, African giant rat (AGR), tree hyrax, civet cat, monitor lizard, python, bushbuck and partridge) using a combination of Ellinghausen McCullough Johnson Harris (EMJH) medium, microscopic agglutination test (MAT), Warthin–Starry silver stain (WSss) and immunohistochemistry. Chi-square test was used with confidence level set at 0.05 to ascertain associations between positive cases and sex and species. Eightytwo (78.1%) samples were culturally positive, while 67.7% (63/93), 57.0% (16/28) and 66.7% (8/12) were WSss, MAT and immunohistochemically positive, respectively. Interstitial nephritis (41.0%) and tubular nephrosis (81.0%) were the most prominent histopathological changes. Pathogenic Leptospira organisms were highest in GCR (32.1%) and antelope (14.3%). Serovars hardjo (11.54%), bratislava (3.9%), canicola (3.9%), icterohaemorrhagiae (15.4%), pomona (7.14%) gripptotyphosa (19.2%) and undetermined isolates were also detected in other animals. The result showed high prevalence of Leptospira infection in the wild and the possibility of domestic animals and humans contracting the disease. This study is the first documentation of evidence of pathogenic Leptospira species in wildlife in Nigeria.
Objectives:
Bacteremia due to invasive Salmonella enterica has been reported earlier in children in Nigeria. This study aimed to detect the virulence and antibiotic resistance genes of invasive ...Salmonella enterica from children with bacteremia in north-central Nigeria.
Method:
From June 2015 to June 2018, 4163 blood cultures yielded 83 Salmonella isolates. This is a secondary cross-sectional analysis of the Salmonella isolates. The Salmonella enterica were isolated and identified using standard bacteriology protocol. Biochemical identifications of the Salmonella enterica were made by Phoenix MD 50 identification system. Further identification and confirmation were done with polyvalent antisera O and invA gene. Antimicrobial susceptibility testing was done following clinical and laboratory standard institute guidelines. Resistant genes and virulence genes were determined using a real-time polymerase chain reaction.
Result:
Salmonella typhi 51 (61.4%) was the most prevalent serovar, followed by Salmonella species 13 (15.7%), choleraesuis 8 (9.6%), enteritidis 6 (7.2%), and typhimurium 5 (6.1%). Fifty-one (61.4%) of 83 Salmonella enterica were typhoidal, while 32 (38.6%) were not. Sixty-five (78.3%) of the 83 Salmonella enterica isolates were resistant to ampicillin and trimethoprim-sulfamethoxazole, followed by chloramphenicol 39 (46.7%), tetracycline 41 (41.4%), piperacillin 33 (33.9%), amoxicillin-clavulanate, and streptomycin 21 (25.3%), while cephalothin was 19 (22.9%). Thirty-nine (46.9%) of the 83 Salmonella enterica isolates were multi-drug resistant, and none were extensive drug resistant or pan-drug resistant. A blaTEM 42 (50.6%), floR 32 (38.6%), qnrA 24 (28.9%), tetB 20 (20.1%), tetA 10 (10.0%), and tetG 5 (6.0%) were the antibiotic resistance genes detected. There were perfect agreement between phenotypic and genotypic detection of antimicrobial resistance in tetracycline, ciprofloxacin, and chloramphenicol, while beta-lactam showed κ = 0.60 agreement. All of the Salmonella enterica isolates had the virulence genes invA, sopB, mgtC, and sip4D, while 33 (39.8%), 45 (51.8%), and 2 (2.4%) had ssaQ, spvC, and ljsGI-1, respectively.
Conclusion:
Our findings showed multi-drug resistant Salmonella enterica in children with bacteremia in northern Nigeria. In addition, significant virulence and antimicrobial resistance genes were found in invasive Salmonella enterica in northern Nigeria. Thus, our study emphasizes the need to monitor antimicrobial resistance in Salmonella enterica from invasive sources in Nigeria and supports antibiotic prudence.
Dermatophilus congolensis, the aetiological agent of dermatophilosis, is a pleomorphic, Gram‐positive actinomycete, which infects animals and humans. Often, there is a wrong diagnosis of the ...infection in animals because of the close resemblance of the organism with other members of the family Actinomycetaceae. In this study, molecular tools were applied to suspected isolates of D. congolensis obtained from naturally infected cattle in Nigeria for confirmation of dermatophilosis. DNA extraction from 54 suspected pure colonies of D. congolensis was carried out using the QIAamp® DNA Mini extraction kit. PCR targeted at the 16S rRNA gene was employed for the confirmation of D. congolensis using 5′‐ACATGCAAGTCGAACGATGA‐3′ and 5′‐ACGCTCGCACCCTACGTATT‐3′ as forward and reverse primers, respectively. Positive amplicons were then sequenced directly using Big Dye Terminator Cycle Sequencing Kit with the forward primers and AmpliTaq‐FS DNA Polymerase. Nucleotide sequences were aligned using bioedit (Ibis Biosciences Carlsbad, CA USA) and the phylogenetic analysis was carried out using mega 5.2 (Center for Evolutionary Medicine and Informatics, The Biodesign Institute, Tempe, Arizona, USA) software programme. The aligned nucleotide sequences of 10 positive D. congolensis isolates had between 94% to 99% homology with the sequences of D. congolensis satellite DNA in GenBank. This result also revealed that the sequenced D. congolensis are of different strains. Phylogenetic analysis revealed that D. congolensis, though closely related to Nocardia brasiliensis (NR 074743.01) and Streptomyces sp. (JN 400114.1), belongs to different genus. In conclusion, molecular tools employed in the study were able to confirm the identity of the test organisms as D. congolensis. It can also be concluded that two strains of D. congolensis obtained from the study can still be accommodated within the previously listed strains available in GenBank while the remaining eight may be different strains of D. congolensis not yet listed in GenBank.
Difficulties in confirming cases of dermatophilosis using the conventional techniques lead us to employ molecular techniques not only to diagnose but also to characterize field strains of D. congolensis in Abeokuta and Ilorin, Nigeria. Fifty‐one of the 54 tested isolates were confirmed by PCR as D. congolensis. Sequence analysis and the phylogenetic analysis of D. congolensis from the study area revealed that two strains of the organism from the study area can still be accommodated within the previously listed strains available in GenBank while the remaining eight may be different strains of D. congolensis not yet listed in GenBank.
Objectives: Bacteremia due to invasive Salmonella enterica has been reported earlier in children in Nigeria. This study aimed to detect the virulence and antibiotic resistance genes of invasive ...Salmonella enterica from children with bacteremia in north-central Nigeria. Method: From June 2015 to June 2018, 4163 blood cultures yielded 83 Salmonella isolates. This is a secondary cross-sectional analysis of the Salmonella isolates. The Salmonella enterica were isolated and identified using standard bacteriology protocol. Biochemical identifications of the Salmonella enterica were made by Phoenix MD 50 identification system. Further identification and confirmation were done with polyvalent antisera O and inv A gene. Antimicrobial susceptibility testing was done following clinical and laboratory standard institute guidelines. Resistant genes and virulence genes were determined using a real-time polymerase chain reaction. Result: Salmonella typhi 51 (61.4%) was the most prevalent serovar, followed by Salmonella species 13 (15.7%), choleraesuis 8 (9.6%), enteritidis 6 (7.2%), and typhimurium 5 (6.1%). Fifty-one (61.4%) of 83 Salmonella enterica were typhoidal, while 32 (38.6%) were not. Sixty-five (78.3%) of the 83 Salmonella enterica isolates were resistant to ampicillin and trimethoprim-sulfamethoxazole, followed by chloramphenicol 39 (46.7%), tetracycline 41 (41.4%), piperacillin 33 (33.9%), amoxicillin-clavulanate, and streptomycin 21 (25.3%), while cephalothin was 19 (22.9%). Thirty-nine (46.9%) of the 83 Salmonella enterica isolates were multi-drug resistant, and none were extensive drug resistant or pan-drug resistant. A bla TEM 42 (50.6%), flo R 32 (38.6%), qnr A 24 (28.9%), tet B 20 (20.1%), tet A 10 (10.0%), and tet G 5 (6.0%) were the antibiotic resistance genes detected. There were perfect agreement between phenotypic and genotypic detection of antimicrobial resistance in tetracycline, ciprofloxacin, and chloramphenicol, while beta-lactam showed κ = 0.60 agreement. All of the Salmonella enterica isolates had the virulence genes inv A, sop B, mgt C, and sip 4D, while 33 (39.8%), 45 (51.8%), and 2 (2.4%) had ssa Q, spv C, and ljs GI-1, respectively. Conclusion: Our findings showed multi-drug resistant Salmonella enterica in children with bacteremia in northern Nigeria. In addition, significant virulence and antimicrobial resistance genes were found in invasive Salmonella enterica in northern Nigeria. Thus, our study emphasizes the need to monitor antimicrobial resistance in Salmonella enterica from invasive sources in Nigeria and supports antibiotic prudence.
Background
Messenger RNA (mRNA) vaccines emerged as a powerful tool in the fight against infections. Unlike traditional vaccines, this unique type of vaccine elicits robust and persistent innate and ...humoral immune response with a unique host cell‐mediated pathogen gene expression and antigen presentation.
Methods
This offers a novel approach to combat poxviridae infections. From the genome of vaccinia and Mpox viruses, three key genes (E8L, E7R, and H3L) responsible for virus attachment and virulence were selected and employed for designing the candidate mRNA vaccine against vaccinia and Mpox viral infection. Various bioinformatics tools were employed to generate (B cell, CTL, and HTL) epitopes, of which 28 antigenic and immunogenic epitopes were selected and are linked to form the mRNA vaccine construct. Additional components, including a 5′ cap, 5′ UTR, adjuvant, 3′ UTR, and poly(A) tail, were incorporated to enhance stability and effectiveness. Safety measures such as testing for human homology and in silico immune simulations were implemented to avoid autoimmunity and to mimics the immune response of human host to the designed mRNA vaccine, respectively. The mRNA vaccine's binding affinity was evaluated by docking it with TLR‐2, TLR‐3, TLR‐4, and TLR‐9 receptors which are subsequently followed by molecular dynamics simulations for the highest binding one to predict the stability of the binding complex.
Results
With a 73% population coverage, the mRNA vaccine looks promising, boasting a molecular weight of 198 kDa and a molecular formula of C8901H13609N2431O2611S48 and it is said to be antigenic, nontoxic and nonallergic, making it safe and effective in preventing infections with Mpox and vaccinia viruses, in comparison with other insilico‐designed vaccine for vaccinia and Mpox viruses.
Conclusions
However, further validation through in vivo and in vitro techniques is underway to fully assess its potential.
The article presents the development of a novel messenger RNA (mRNA) vaccine targeting poxviridae infections. Through bioinformatics analysis and molecular simulations, the vaccine construct containing 28 antigenic epitopes was designed, with safety measures to avoid autoimmunity. The mRNA vaccine demonstrated promise, showing potential for preventing infections with Mpox and vaccinia viruses.
Verocytotoxin-producing Escherichia coli (VTEC) O157:H7 is a predominant cause of haemorrhagic colitis (HC) and haemolytic uraemic syndrome (HUS) in humans. To assess the role of dogs as a possible ...source of transmission of VTEC O157:H7 to humans, the faeces of diarrhoeic (31) and non-diarrhoeic (63) dogs were examined for the presence of the organism. Escherichia coli O157:H7 was isolated from 22 (23.4%) out of 94 samples examined. The organism was detected in 5 (16.1%) out of 31 diarrhoeic faeces and 17 (26.9%) out of 63 non-diarrhoeic faeces, but the difference was not statistically significant (P>0.05). All the E. coli O157:H7 isolates produced one or both of verocytotoxin 1 and 2 (VT1 and VT2). Verocytotoxin 1 (VT1) was detected in 10 (45.5%) out of 22 isolates, VT2 in 8 (36.4%), while both toxin types were detected in four (18.2%) isolates. Sixteen (72.7%) out of 22 isolates were resistant to at least three antimicrobials from different classes, while 18 distinct antimicrobial resistance patterns were observed among the isolates. The isolates showed resistance to ampicillin (86.4%), chloramphenicol (36.4%), ciprofloxacin (4.5%), gentamicin (18.2%), kanamycin (68.2%), nalidixic acid (22.7%), neomycin (40.9%), norfloxacin (9.1%), streptomycin (63.6%), sulphamethoxazole/trimethoprim (63.6%) and tetracycline (77.3%). The present study showed that diarrhoeic and non-diarrhoeic dogs may serve as potential sources of multi-drug resistant VTEC O157:H7 transmissible to humans. Key words: dogs, E. coli O157:H7, faeces, multi-drug resistance, verocytotoxin Verotoksicni sojevi bakterije Escherichia coli (VTEC) O157:H7 pretezito uzrokuju hemoragijski kolitis (HC) i hemoliticko-uremijski sindrom (HUS) u ljudi. Radi procjene uloge pasa kao moguceg izvora prijenosa VTEC O157:H7 na ljude, pretrazeni su uzorci njihova proljeva (31) i normalno formiranog fecesa (63) na prisutnost te bakterije. Escherichia coli O157:H7 bila je izdvojena iz 22 (23,4%) od 94 pretrazena uzorka. Bila je dokazana u 5 (16,1%) od 31 uzorka proljeva i 17 (26,9%) od 63 uzorka normalno formiranog izmeta. Nije bila ustanovljena statisticki znacajna razlika (P>0,05). Svi izolati bakterije E. coli O157:H7 proizvodili su jedan ili oba verotoksina: 1 i 2 (VT1 i VT2). Verotoksin 1 bio je dokazan u 10 (45,5%) od 22 izolata, VT2 u osam (36,4%), dok su oba tipa toksina bila dokazana u cetiri (18,2%) izolata. Sesnaest (72,7%) od 22 izolata bilo je otporno na najmanje tri antimikrobne tvari razlicitih skupina. Medu izolatima je bilo ustanovljeno 18 razlicitih obrazaca otpornosti na antimikrobne tvari. Izolati su pokazivali otpornost na ampicilin (86,4%), kloramfenikol (36,4%), ciprofl oksacin (4,5%), gentamicin (18,2%), kanamicin (68,2%), nalidiksicnu kiselinu (22,7%), neomicin (40,9%), norfl oksacin (9,1%), streptomicin (63,6%), sulfametoksazol/trimetoprim (63,6%) i tetraciklin (77,3%). Istrazivanje je pokazalo da psi s proljevom i bez proljeva mogu biti izvor multiplorezistentne VTEC O157:H7 za ljude. Kljucne rijeci: pas, E. coli O157:H7, izmet, visestruka otpornost, verotoksin
Antimicrobial resistance in bacteria from the family Enterobacteriaceae is an important indicator of the emergence of resistant bacterial strains in the community. This study investigated the ...antimicrobial susceptibility of commensal Enterobacteriaceae from free-range chickens to antimicrobial agents using the broth microdilution. In all, 184 isolates (including 104 Escherichia coli, 44 Klebsiella spp, 20 Salmonella spp. and 16 Enterobacter aerogenes) were resistant to ampicillin (89.7%), chloramphenicol (73.9%), ciprofloxacin (33.2%), enrofloxacin (60.3%), neomycin (70.7%), norfloxacin (45.7%), streptomycin (78.8%) and tetracycline (73.4%). Escherichia coli was resistant to ampicillin (92.3%), chloramphenicol (73.1%), ciprofloxacin (34.6%), enrofloxacin (61.5%), neomycin (76.9%), norfloxacin (46.2%), streptomycin (80.8%) and tetracycline (76.9%). The rate of resistance in Klebsiella spp. was ampicillin (90.9%), chloramphenicol (72.7%), ciprofloxacin (54.5%), enrofloxacin (90.9%), neomycin (63.6%), norfloxacin (63.6%), streptomycin (81.8%) and tetracycline (81.8%). Salmonella spp. showed resistance to ampicillin (80.0%), chloramphenicol (80.0%), enrofloxacin (20.0%), neomycin (80.0%), norfloxacin (20.0%), streptomycin (80.0%) and tetracycline (35.0%) but were completely susceptible to ciprofloxacin. Enterobacter aerogenes was resistant to ampicillin (81.3%), chloramphenicol (75.0%), ciprofloxacin (6.3%), enrofloxacin (18.8%), neomycin (37.5%), norfloxacin (25.0%), streptomycin (56.3%) and tetracycline (75.0%). Overall, 147 (79.9%) out of 184 isolates demonstrated multidrug resistance to at least three unrelated antimicrobial agents. The high rate of antimicrobial resistance in bacterial isolates from free-range birds may have major implications for human and animal health with adverse economic implications. Key words: multidrugresistance, commensal Enterobacteriaceae, free-range chickens Otpornost bakterija porodice Enterobacteriaceae na antimikrobne lijekove vazan je pokazatelj pojave otpornih sojeva u populaciji. U ovom je radu mikrodilucijskim postupkom bila istrazena osjetljivost na antimikrobne lijekove bakterija porodice Enterobacteriaceae izdvojenih iz pilica u slobodnom sustavu drzanja. Od 184 izolata (104 izolata bakterije Escherichia coli, 44 Klebsiella spp., 20 Salmonella spp. i 16 Enterobacter aerogenes) na ampicilin je bilo otporno 89,7% izolata, na klormafenikol 73,9%, ciprofloksacin 33,2%, enrofloksacin 60,3%, neomicin 70,7%, norfloksacin 45,7%, streptomicin 78,8% i tetraciklin 73,4%. Izolati bakterije Escherichia coli bili su otporni na ampicilin (92,3%), kloramfenikol (73,1%), ciprofloksacin (34,6%), enrofloksacin (61,5%), neomicin (76,9%), norfloksacin (46,2%), streptomicin (80,8%) i tetraciklin (76,9%). Stopa otpornosti bakterija roda Klebsiella bila je za ampicilin 90,9%, kloramfenikol 72,7%, ciprofloksacin 54,5%, enrofloksacin 90,9%, neomicin 63,6%, norfloksacin 63,6%, streptomicin 81,8% i tetraciklin 81,8%. Izolati Salmonella spp. pokazivali su otpornost na ampicilin (80,0%), kloramfenikol (80,0%), enrofloksacin (20,0%), neomicin (80,0%), norfloksacin (20,0%), streptomicin (80,0%) i tetraciklin (35,0%), ali su u potpunosti bili osjetljivi na ciprofloksacin. Izolati Enterobacter aerogenes su bili otporni na ampicilin (81,3%), kloramfenikol (75,0%), ciprofloksacin (6,3%), enrofloksacin (18,8%), neomicin (37,5%), norfloksacin (25,0%), streptomicin (56,3%) i tetraciklin (75,0%). Sveukupno je 147 (79,9%) od 184 izolata pokazivalo visestruku otpornost na najmanje tri nesrodna antimikrobna lijeka. Veliki postotak bakterijskih izolata iz slobodno drzanih pilica na antimikrobne lijekove moze biti od znatne vaznosti za ljudsko i zivotinjsko zdravlje s nepovoljnim gospodarskim ucinkom. Kljucne rijeci: visestruka otpornost na lijekove, Enterobacteriaceae, slobodno drzani pilici