Summary
Synthetic promoters may be designed using short cis‐regulatory elements (CREs) and core promoter sequences for specific purposes. We identified novel conserved DNA motifs from the promoter ...sequences of leaf palisade and vascular cell type‐specific expressed genes in water‐deficit stressed poplar (Populus tremula × Populus alba), collected through low‐input RNA‐seq analysis using laser capture microdissection. Hexamerized sequences of four conserved 20‐base motifs were inserted into each synthetic promoter construct. Two of these synthetic promoters (Syn2 and Syn3) induced GFP in transformed poplar mesophyll protoplasts incubated in 0.5 M mannitol solution. To identify effect of length and sequence from a valuable 20 base motif, 5′ and 3′ regions from a basic sequence (GTTAACTTCAGGGCCTGTGG) of Syn3 were hexamerized to generate two shorter synthetic promoters, Syn3‐10b‐1 (5′: GTTAACTTCA) and Syn3‐10b‐2 (3′: GGGCCTGTGG). These promoters' activities were compared with Syn3 in plants. Syn3 and Syn3‐10b‐1 were specifically induced in transient agroinfiltrated Nicotiana benthamiana leaves in water cessation for 3 days. In stable transgenic poplar, Syn3 presented as a constitutive promoter but had the highest activity in leaves. Syn3‐10b‐1 had stronger induction in green tissues under water‐deficit stress conditions than mock control. Therefore, a synthetic promoter containing the 5′ sequence of Syn3 endowed both tissue‐specificity and water‐deficit inducibility in transgenic poplar, whereas the 3′ sequence did not. Consequently, we have added two new synthetic promoters to the poplar engineering toolkit: Syn3‐10b‐1, a green tissue‐specific and water‐deficit stress‐induced promoter, and Syn3, a green tissue‐preferential constitutive promoter.
Zusammenfassung
Die Therapie von Aortenerkrankungen erfolgt heute, wann immer möglich und sinnvoll, im minimalinvasiven/interventionellen Ansatz. Gleichwohl oder gerade deshalb ist es essenziell, ...auch die offen-chirurgischen Zugangswege zu den verschiedenen Abschnitten der (thorako-)abdominellen Aorta zu kennen, um im Bedarfsfall schnell und zielgerichtet handeln zu können. Unter Berücksichtigung der anatomischen Lokalisation, der Dringlichkeit und des Umfangs der lokal durchzuführenden chirurgischen Maßnahmen stellt die vorliegende Arbeit die verschiedenen Zugangswege zur (thorako-)abdominellen Aorta mit ihren jeweils assoziierten Vor- und Nachteilen dar. Ergänzend findet sich eine Zusammenstellung der heute zum Aortenersatz verfügbaren Materialien.
Salinity inhibits plant growth due to ionic and osmotic effects on metabolic processes and nutritional balance, leading to impaired physiological functions. Selenium (Se) and silicon (Si) can be ...partially alleviated by the effects wrought by NaCl on the plant metabolism. Iodine (I), applied as iodate (IO₃ ⁻) in biofortification programmes, has been confirmed to improve the antioxidant response in lettuce plants. Thus, the aim of this study was to determine whether the application of IO₃ ⁻ can improve the response to severe salinity stress in lettuce (Lactuca sativa cv. Philipus). In this work, the application of IO₃ ⁻ (20-80μM) in lettuce plants under salinity stress (100mM of NaCl) exerted a significantly positive effect on biomass and raised the levels of soluble sugars while lowering the Na⁺ and Cl⁻ concentrations as well as boosting the activity of antioxidant enzymes such as SOD, APX, DHAR and GR. Therefore, IO₃ ⁻ could be considered a possibly beneficial element to counteract the harmful effects of salinity stress.
► N-deficiency-induced senescence, the rise in ROS trigger oxidative stress. ► Transgenic plants expressing IPT gene coding the rate-limiting step in CKs synthesis. ► WT plants under N-limited, ...reduced biomass and increased the generation of ROS. ► Transgenic plants under N-limited, did not produce high ROS and maintained biomass. ► The expression of P
SARK∷IPT in plants could improve nitrogen use efficiency.
Wild type and transgenic tobacco plants expressing isopentenyltransferase, a gene coding the rate-limiting step in cytokinin synthesis, were grown under limited nitrogen (N) conditions. Our results indicated that the WT plants subjected to N deficiency displayed reduced biomass and relative growth rates, increased levels of oxidative damage and reduced foliar concentrations of the different N forms. However, the transgenic plants expressing P
SARK∷IPT, in spite of showing a significant decline in all the N forms in the leaf, avoided the alteration of the oxidative metabolism and maintained biomass and the relative growth rates at control levels, under suboptimal N conditions. These results suggest that the increased cytokinin synthesis in the transgenic plants is an effective mechanism to improve N-use efficiency.
Laser-assisted bioprinting (LaBP) allows the realization of computer-generated 3D tissue grafts consisting of cells embedded in a hydrogel environment. In this study, human adipose-derived stem cells ...(hASCs) were printed in a free-scalable 3D grid pattern by means of LaBP. We demonstrate that neither the proliferation ability nor the differentiation behaviour of the stem cells was affected by the LaBP procedure. Furthermore, the 3D grafts were differentiated down the adipogenic lineage pathway for 10 days. We verify by quantitative assessments of adipogenic markers that the 3D grafts resemble cell lineages present in natural adipose tissue. Additionally, we provide the proof that even pre-differentiated hASCs could be utilized for the generation of 3D tissue grafts. These results indicate that the biofabrication of living grafts resembling their complex native origin is within reach.
One of the most promising approaches in tissue engineering is the application of 3D scaffolds, which provide cell support and guidance in the initial tissue formation stage. The porosity of the ...scaffold and internal pore organization influence cell migration and play a major role in its biodegradation dynamics, nutrient diffusion and mechanical stability. In order to control cell migration and cellular interactions within the scaffold, novel technologies capable of producing 3D structures in accordance with predefined design are required. The two-photon polymerization (2PP) technique, used in this report for the fabrication of scaffolds, allows the realization of arbitrary 3D structures with submicron spatial resolution. Highly porous 3D scaffolds, produced by 2PP of acrylated poly(ethylene glycol), are seeded with cells by means of laser-induced forward transfer (LIFT). In this laser printing approach, a propulsive force, resulting from laser-induced shock wave, is used to propel individual cells or cell groups from a donor substrate towards the receiver substrate. We demonstrate that with this technique printing of multiple cell types into 3D scaffolds is possible. Combination of LIFT and 2PP provides a route for the realization of 3D multicellular tissue constructs and artificial ECM engineered on the microscale.
To gain an insight into the role of lignification and membrane permeability in the root response to boron (B) toxicity, lignification-related enzymes and a number of physiological and oxidative ...stress parameters were analyzed in two tomato (Solanum lycopersicum L.) cultivars (Kosaco and Josefina) subjected to 0.05 (control), 0.5 and 2mM B during 16 days. 2mM B supply inhibited root growth and increased the root B concentration in both tomato cultivars. Although excess B increased the hydrogen peroxide (H2O2) concentration in Kosaco, no major changes were observed in other oxidative-stress-related parameters. High levels of B supply also induced higher lignin deposition in Kosaco roots but did not in Josefina ones. The latter result was associated with an increase of the polyphenol oxidase (PPO), guaiacol peroxidase (GPOX) and soluble syringaldazine peroxidase (SPOX) activity in Kosaco roots. Boron toxicity did not induce lipid peroxidation but increased the leakage of K+ and the passive efflux of B in tomato roots. We conclude that high concentrations of B do not cause major oxidative or membrane damage in tomato roots. The data also indicate that high levels of B supply induce a higher lignin deposition in Kosaco roots but not in Josefina ones. This phenomenon suggests that lignification is not an essential factor reducing root growth in tomato plants, however, it proves that exist a high genotypic variation in response to excess B at root level.
The mineral composition and maintenance of mineral balance are important to growth and development of plants. The selenium (Se) has not been described as an essential element for plants, although ...there are studies that have demonstrated to interaction between Se with other mineral nutrients. The aim was to evaluate the influence that Se application at different rates and forms exerts on the nutritional state in lettuce plants. The plants were grown under different treatments: 5, 10, 20, 40, 60, 80, 120 μmol L⁻¹ as sodium selenate Na₂SeO₄ or Na₂SeO₃. All the plants growth under controlled conditions. The results showed changes in some of the essential nutrients inside of plants such as nitrogen (N), phosphorous (P), iron (Fe), copper (Cu), calcium (Ca). The effect of Se depended largely on the Se from was applied to the culture medium. Thus, the selenite application had a stronger effect on the nutritional state of the plant.
Atherosclerosis is a hallmark of cardiovascular disease. Shear stress on endothelial cells has been linked to atherogenesis and to fibrous cap thinning and rupture. Pericytes reside in the ...sub-endothelial space of vessels and have vasoprotective effects. They are subjected to shear stress when endothelial cell integrity is disrupted. The aim was to investigate the susceptibility and response of pericytes to shear stress.
Endothelial cells and pericytes were seeded in two dimensional monocultures and co-cultures, and in a novel three dimensional co-culture system and were subjected to no, low and high shear stress (0, 10, 30 dyne/cm2) for 48 h. The morphological response to flow was assessed by histology and the expression of extracellular matrix proteins was analysed using quantitative polymerase chain reaction, immunoblotting, and ELISA.
While endothelial cells aligned into flow direction, pericytes aligned perpendicularly (p < .001), indicating that they must be capable of sensing flow. When pericytes were embedded into a 3D matrix they showed similar alignment and pericytes built long processes towards the lumen. Under shear stress endothelial cells upregulated “a disintegrin and metalloproteinase with thrombospondin motif 1” (ADAMTS-1) (p < .01) and pericytes upregulated “tissue inhibitor of matrix metalloproteinase” (TIMP) 3 (p < .05), an inhibitor of ADAMTS-1, meanwhile differential expression of extracellular matrix (ECM) proteins could be detected in co-cultures of both cells. For TIMP3 expression direct cell–cell contact between endothelial cells and pericytes was required.
The experiments highlight that pericytes are able to sense direct flow thereby regulating ECM proteins known to be involved in vascular remodelling. Furthermore, pericytes counter-regulate endothelial ADAMTS-1 by protective TIMP3 expression to prevent matrix degradation and maintain vascular stability. For this protective effect direct cell contact was necessary. This observation might represent an adaptive, protective mechanism of pericytes to counteract endothelial damage in the onset of atherosclerosis.
BACKGROUND: Considering the economic importance of tomato and its nutritional benefits to human health, a study was conducted on how different environmental factors (temperature, solar radiation and ...vapour pressure deficit (VPD)) influence hydrogen peroxide detoxification and several stress indicators in cherry tomato (Solanum lycopersicum cv. Naomi) fruits grown in two experimental Mediterranean greenhouses of parral (low-technology) type and multispan (high-technology) type.RESULTS: Three fruit samplings were made at the beginning, middle and end of the fruit production period. Values of temperature, solar radiation and VPD peaked at the third sampling in both greenhouses, being higher in the parral-type greenhouse, while there was a reduction in market production at the third sampling. Peroxidation (malondialdehyde content and lipoxygenase activity) increased significantly at the third sampling, indicating the presence of oxidative stress caused by the rise in temperature, solar radiation and VPD. The ascorbate content, the activities of superoxide dismutase, catalase and ascorbate peroxidase and other stress indicators (proline and sucrose degradation) also increased at the third sampling.CONCLUSION: This study showed that conditions of higher environmental stress occurred at the third sampling and in the parral-type greenhouse, leading to the accumulation of ascorbic acid in cherry tomato fruits and therefore to higher nutritional quality.
PDF
