The treatment of contaminants from lignocellulosic biorefinery effluent has recently been identified as a unique challenge. This study focuses on removing phenolic contaminants and polycyclic ...aromatic hydrocarbons (PAHs) from lignocellulosic biorefinery wastewater (BRW) applying a laccase-assisted approach. Cassava waste was used as a substrate to produce the maximum yield of laccase enzyme (3.9 U/g) from Pleurotus ostreatus. Among the different inducers supplemented, CuSO4 (0.5 mM) showed an eight-fold increase in enzyme production (30.8 U/g) after 240 h of incubation. The catalytic efficiency of laccase was observed as 128.7 ± 8.47 S−1mM−1 for syringaldazine oxidation at optimum pH 4.0 and 40 °C. Laccase activity was completely inhibited by lead (II) ion, mercury (II) ion, sodium dodecyl sulphate, sodium azide and 1,4 dithiothretiol and induced significantly by manganese (II) ion and rhamnolipid. After treating BRW with laccase, the concentrations of PAHs and phenolic contaminants of 1144 μg/L and 46160 μg/L were reduced to 96 μg/L and 16100 μg/L, respectively. The ability of laccase to effectively degrade PAHs in the presence of different phenolic compounds implies that phenolic contaminants may play a role in PAHs degradation. After 240 h, organic contaminants were removed from BRW in the following order: phenol >2,4-dinitrophenol > 2-methyl-4,6-dinitrophenol > 2,3,4,6-tetrachlorophenol > acenaphthene > fluorine > phenanthrene > fluoranthene > pyrene > anthracene > chrysene > naphthalene > benzo(a)anthracene > benzo(a)pyrene > benzo(b)fluoranthene > pentachlorophenol > indeno(1,2,3-cd)pyrene > benzo(j) fluoranthene > benzokfluoranthène. The multiple contaminant remediation from the BRW by enzymatic method, clearly suggests that the laccase can be used as a bioremediation tool for the treatment of wastewater from various industries.
Display omitted
•Pleurotus ostreatus was grown on starch-based industry waste to produce laccase.•After 240 h of fermentation, 0.5 mM CuSO4 induced 30 U/g of laccase production.•Wastewater exhibits the presence of 15 PAHs (1.1 mg/L) and 5 phenols (46.3 mg/L).•91% of PAHs and 65% of phenolic compounds were remediated by laccase in wastewater.•Low molecular weight PAHs have higher remediation rates by enzymatic treatment.
Display omitted
•An α-galactosidase was highly purified from Pleurotus citrinopileatus fruiting bodies.•It exhibited remarkable resistance to protease.•It could efficiently hydrolyze RFOs.•Galactose ...(Ki=0.92mM) and melibiose (Ki=7.13mM) competitively inhibited the enzyme.•It was strongly inhibited by Cd2+, Cu2+, Hg2+, Al3+, Fe3+ and Ag+ ions.
An acidic α-galactosidase designated as PCGI was isolated from the fruiting bodies of Pleurotus citrinopileatus with 264-fold purification and a specific activity of 7.92units/mg. It was purified to homogeneity by ion exchange chromatography and gel filtration chromatography. PCGI is a heterodimeric protein consisting of a 33kDa and a 27kDa subunit in SDS-PAGE. The purified enzyme was identified by MALDI-TOF-MS. It belongs to the GH27 family. The optimum pH and temperature of the enzyme with pNPGal as substrate were 4.4 and 50°C, respectively. Besides, it displayed remarkable resistance to acid protease, neutral protease, α-chymotrypsin, and trypsin. It was strongly inhibited by Cd2+, Cu2+, Hg2+, Al3+, Fe3+ and Ag+ ions. Diethypyrocarbonate (DEPC) doubled the activity of PCGI whereas N-bromosuccinimide (NBS) drastically decreased it. PCGI displayed wide substrate diversity with activity toward substrates such as stachyose, raffinose, melibiose. The Km values for hydrolysis of pNPGal, stachyose, raffinose, and melibiose were 0.2, 16.7, 18.9, and 6.3mM, respectively. Galactose (Ki=0.92mM) and melibiose (Ki=7.13mM) competitively inhibited the enzymes. Futhermore, it completely degraded raffinose and sthachyose. These results suggest that PCGI has great potential for removal of the non-digestible and flatulence-causing oligosaccharides stachyose and raffinose from legumes.
Infestations of fungus gnats (Diptera: Sciaridae) can reduce the production of oyster mushrooms (Pleurotus spp.) grown as food crops within controlled environments. The objectives of this study were ...to assess the efficacy of Bacillus thuringiensis var. israelensis (Bti) and Steinernema feltiae against fungus gnat larvae. A bioassay was developed, whereby pasteurized straw was inoculated with Pleurotus columbinus and treated with Bti (Gnatrol®), S. feltiae (Nemashield®), or water. Fungus gnats (Lycoriella sp.) were released into each bioassay container for ovipositing onto the straw, thereby exposing the F1 larvae to treated or untreated substrate. Sticky cards within the containers entrapped fungus gnats emerging from the substrate as an indicator of larval survivorship. Following three bioassays, fewer fungus gnats emerged from straw treated with Bti compared to S. feltiae and the water control. Three additional bioassays using Pleurotus ostreatus also demonstrated that fewer fungus gnats emerged from straw treated with Bti compared to S. feltiae and the untreated control. Steinernema feltiae was generally ineffective. Monitoring substrate weight in the bioassay containers over time indicated that Bti and S. feltiae did not impede colonization by P. ostreatus. Incorporating Bti into straw substrate is a promising approach for managing fungus gnats infesting Pleurotus spp.
Celotno besedilo
Dostopno za:
DOBA, IZUM, KILJ, NUK, PILJ, PNG, SAZU, UILJ, UKNU, UL, UM, UPUK
Display omitted
•Effluent from wood-laminate industry has high pollution potential to ecosystems.•Integrated processes for bioremediation of effluent from wood-laminate industry.•Synergism between ...photo-Fenton and microbial processes to effluent detoxification.•Toxic effluent bioremediation in air-lift reactor using Pleurotus ostreatus EB 016.
The present study reports on the remediation of an effluent from the wood-laminate industry using Pleurotus ostreatus EB 016 in combination with photo-Fenton oxidation. Fermentation of the effluent with P. ostreatus EB-016 was carried out in agitated flasks to evaluate the influence of pH, and concentrations of carbon and nitrogen sources by a multivariate approach. Subsequently, bioassays was conducted in an air-lift bioreactor using the pre-optimized conditions. In addition, photo-Fenton oxidative treatment was employed to degrade recalcitrant compounds, and the ecotoxicity of the effluents were evaluated using Escherichia coli as a biological model. The crude effluent presented high contents of total phenolics (1,220 mg/L), solids (18.45 g/L) and color intensity (8,333 CU), besides high values of chemical (COD 2,477 mg O2./L) and biochemical (BOD5, 8,450 mg O2/L) oxygen demand. Another feature was the high inhibition on Escherichia coli (71%). Reduction of 64% COD was obtained under optimized conditions (pH5.7, 7.5 g/L sucrose, 4.0 g/L ammonium nitrate) in agitated flasks after 10 days treatment. In the air-lift reactor, 50.6% COD and 29.9% total phenols were removed after 10 days. Combination of biotreatment with photo-Fenton oxidation resulted in removal of 99.2% COD and 92.2% phenolics and absence of inhibition on Escherichia coli.
White rot fungi are well known for their ability to degrade xenobiotics in pure cultures but few studies focus on their performance under bacterial stress in real wastewaters. This study investigated ...mutual interactions in co-cultures of
Pleurotus ostreatus
and activated sludge microbes in batch reactors and different culture media. Under the bacterial stress an increase in the dye decolorization efficiency (95 vs. 77.1 %) and a 2-fold elevated laccase activity (156.7 vs. 78.4 Ul
−1
) were observed in fungal-bacterial cultures compared to pure
P. ostreatus
despite a limited growth of bacteria in mixed cultures. According to 16S-rDNA analyses,
P. ostreatus
was able to alter the structure of bacterial communities. In malt extract-glucose medium the fungus inhibited growth of planktonic bacteria and prevented shifts in bacterial utilization of potential C-sources. A model bacterium,
Rhodococcus erythropolis
responded to fungal metabolites by down regulation of uridylate kinase and acetyl-CoA synthetase.
Graphical Abstract
•MAE and PLE were compared as modern technologies to obtain mushroom polysaccharides.•Extraction effectiveness was determined by response surface methodology (RSM).•The variable responses were total ...carbohydrate content and polysaccharide yields.•Temperature showed strong positive influence in the polysaccharide extraction.•NMR data indicated the presence of β- and α-glucans and heteropolysaccharides.
Microwave-assisted extraction (MAE) and pressurized liquid extraction (PLE) were compared as advanced technologies to obtain polysaccharides (particularly biologically active β-glucans) from Pleurotus ostreatus and Ganoderma lucidum fruiting bodies. Extraction effectiveness was compared by a full-factorial experimental design (response surface methodology, RSM), using water as extraction solvent. Total carbohydrate content of the obtained extracts and polysaccharide yields were the variable responses investigated, while temperature and extraction time were the experimental factors. Temperature showed stronger influence in the polysaccharide extraction than time. The latter factor slightly affected MAE but not PLE extractions. Optimal conditions within the studied range were determined for each extraction method and species based on the desirability functions. Regarding the polysaccharide composition, the main differences between the species were more quantitative rather than qualitative, since NMR analyses indicated that all extracts contained mainly β- and α-glucans and heteropolysaccharides. Both extraction systems were effective for polysaccharide extraction from mushrooms.
Neurodegenerative diseases are considered to be among the diseases most threatening to human beings. Increasing evidence shows that antioxidant hydrolysates/peptides with neuroprotective effects may ...relieve neurodegenerative diseases. However, related research in mushrooms, one of the richest sources of antioxidant hydrolysates/peptides, is in its infancy. Therefore, the in vitro neuroprotective effects of protein hydrolysates from Pleurotus geesteranus were researched in this study. Proteins were extracted from P. geesteranus and then hydrolyzed by simulated gastrointestinal digestion. The neuroprotective effects of the protein hydrolysates were evaluated by H
O
-injured PC12 cells. The hydrolysates showed a superior antioxidative ability and had a higher abundance of hydrophobic amino acids (e.g., leucine, alanine, and phenylalanine). Neither cytotoxicity nor the increase of ROS in PC12 cells was observed under treatment with the hydrolysates. However, pre-treatment with the hydrolysates in PC12 cells, which were then injured by H
O
, markedly attenuated ROS generation and enhanced the activities and mRNA expression of the endogenous antioxidant enzymes (catalase (CAT), glutathione peroxidase (GPx), and superoxide dismutase (SOD)), leading to a 26.68% increase in cell viability. The hydrolysates exhibited strong neuroprotective activity in H
O
-injured PC12 cells, possibly by reducing ROS generation and enhancing the activity of the antioxidant enzymatic system. PRACTICAL APPLICATIONS: Antioxidant hydrolysates with neuroprotection were obtained from Pleurotus geesteranus proteins by simulating gastrointestinal digestion, which exhibited an excellent pre-protective effect in oxidatively damaged PC12 cells. Further study showed that hydrolysates pre-protection may exert antioxidant activities not only as an exogenous antioxidant to scavenge ROS but also as a gene regulator to modulate the endogenous antioxidant enzymes gene expression. These results indicated that the potential of antioxidant peptides, derived from P. geesteranus through gastrointestinal digestion, could serve as a source of bioactive molecules in the prevention, relief or even treatment of neurodegenerative disorders.
This study investigated the potential functions of Pleurotus florida (an edible mushroom) in the biodegradation of gas oil at concentrations of 0 (control), 2.5, 5, and 10% (V: V) for 30 days. The ...gas oil increased dry weight and protein concentration in all treatments (by an average of 19.5 and 108%, respectively). Moreover, the pH, surface tension (ST), and interfacial tension (IFT) were reduced by the mushroom supplementation. The lowest surface tension (31.9 mN m−1) and the highest biosurfactant production belonged to the 10% gas oil treatment (0.845 ± 0.03 mg mL−1). The results demonstrated that the adsorption isotherm agreed well with the Langmuir isotherm. The maximum Langmuir adsorption capacity was calculated at 0.743 mg g−1 wet biomass of P. florida. The fungal supplementation efficiently remedied the total petroleum hydrocarbons (TPHs) by an average of 55% after 30 days. Gas chromatography (GC) analysis revealed that P. florida effectively detoxified C13–C28 hydrocarbons, Pristane, and Phytane, implying its high mycoremediation function. The toxicity test showed that mycoremediation increased the germination by an average of 35.82% ± 8.89 after 30 days. Laccase activity increased significantly with increasing gas oil concentration in the treatments. The maximum laccase activity was obtained in the 10% gas oil treatment (142.25 ± 0.72 U L−1). The presence of pollutants was also associated with induction in the tyrosinase activity when compared to the control. These results underline the high mycoremediation capacity of P. florida through the involvement of biosurfactants, laccase, and tyrosinase.
Display omitted
•Pleurotus florida displayed a high potential to remove oil contaminants.•Biosurfactant production showed a direct correlation with gas oil concentration.•Laccase activity correlated with gas oil concentration.•The activity of laccase and tyrosinase had an opposite trend.
Pleurotus pulmonarius is a popular and widely cultivated edible mushroom in China. In November 2021, white blotch disease (3% incidence) was observed on the cap of P. pulmonarius, growing in a ...mushroom farm in Nanning, China. Initially, white blotch (0.7-1.6 cm) appeared on the cap of the young P. pulmonarius, which expanded gradually as the cap grew. However, the fruiting bodies still grew well without rotting. The pathogen causing this phenomenon was isolated from infected cap tissues using a dilution plate technique, sections of tissue (approximately 5×5×5 mm) with white blotch were rinsed three times in sterile deionized water, then, mashed in the sterile 2 ml eppendorf tubes, 1000µl sterile water was added and the suspension was diluted into eight concentrations (10-1~10-8). From each concentration, 120µl suspension was spread on Luria Bertani (LB) medium and incubated for 24 hours at 28°C. Both 10-5 and 10-6 suspensions had single colonies, the dominant single colonies were picked and purified 2-3 times. The purified colonies were round, beige, and opaque, with a raised center and regular, smooth and moist margins. This bacterium is gram negative, short rod-shaped, single polar flagellum, motile, without pods or endospores, and produced fluorescent pigments on King's B medium. Amplified 16S rDNA (1396 bp; OM022022) of four randomly selected colonies using universal primers 27f/1492r, exhibited 100% identity with Pseudomonas (Ps.) mosselii. The partial sequences of the rpoB (1173bp; OM202622), rpoD (734bp; ON469579), gyrB (1383bp; OM202621) and recA (887bp; ON469580) genes of four selected colonies were amplified using primers LAPS5/LAFS27(Tayeb et al. 2005.), PsEG30F/PsEG790R (Mulet et al. 2009), gyrB-R/gyrB-F (Agaras et al. 2018) and recA-F (5'-3' ACGACAACAAGAAGCGCGCCTT)/recA-R (5'-3' CAATGGCCGGGTTCTCTTGCAGGTA) designed in this study, respectively, also exhibited 99%~100% similarities to Ps. mosselii. Phylogenetic analysis showed that isolates cluster with Ps. mosselii. The biochemical tests for isolates were performed via bacterial micro-biochemical reaction tubes (Hangzhou Microbial Reagent Co., LTD), and the results showed the same biochemical characteristics as Ps. mosselii (Positive for arginine dihydrolase, trisodium citrate, urea, lysine, arginine, ornithine and gelatin. Negative for glucosamine, lactose, galactose, rhamnose, maltose, sucrose, arabinose, mannose, xylose, esculoside, inositol, nitrate reduction and malonate) (Dabboussi et al.2002; Soto-Rodriguez et al. 2013). The isolates were identified as Ps. mosselii based on biochemical tests and phylogenetic analysis. This isolate was incubated in LB Broth at 28℃, 160 rpm for 24h and the bacterial cells were collected by centrifugation at 4000 rpm for 10min. The collected bacterial cells were resuspended in sterile deionized water to make a bacterial suspension. For pathogenicity tests, 30µl of bacterial suspension (approximately 1x10^9 CFU/mL) was added to the surface of the cap (3-4cm) of young P. pulmonarius. Sterile deionized water was added as a negative control. All treatments were incubated at 22°C and 80-85% humidity. The experiment was repeated three times with three bags each time. 12 h later, white blotches were visible on all parts of the inoculated mushroom. This disease symptoms were similar to those observed in the original samples. However, no disease phenomena were observed in the negative control group. After the pathogenicity test, we obtained the same pathogen as the initially isolates from infected tissues based on morphological characteristics, 16S rDNA sequences, rpoB, rpoD, gyrB and recA sequences, and biochemical test results. Ps. mosselii was first isolated clinically and described by Dabboussi et al. (2002). It has shown to be pathogenic to Oreochromis niloticus and humans (Soto-Rodriguez et al. 2013; Peña et al. 2019; Leneveu-Jenvrin et al. 2013; Huang et al. 2018.). However, to the best of our knowledge, this is the first report of Ps. mosselii causing white blotch disease in P. pulmonarius worldwide, which negatively affects the commercial value of P. pulmonarius and requires attention of mushroom industry.
Electrical activity of fungus Pleurotus ostreatus is characterised by slow (h) irregular waves of baseline potential drift and fast (min) action potential likes spikes of the electrical potential. An ...exposure of the myceliated substrate to a chloroform vapour lead to several fold decrease of the baseline potential waves and increase of their duration. The chloroform vapour also causes either complete cessation of spiking activity or substantial reduction of the spiking frequency. Removal of the chloroform vapour from the growth containers leads to a gradual restoration of the mycelium electrical activity.
PDF
