Voigt et al. (2021) provide a thorough analysis of the restrictions inherent to the estimation of bat abundance from acoustic surveys, and conclude that limitations of acoustic monitoring impede the ...reliable evaluation of bat fatalities at wind turbines. We argue that acoustic data recorded at the nacelle of wind turbines have been experimentally validated as a useful and appropriate measure of bat collisions. Therefore, acoustic data can be used to estimate bat fatalities at wind turbines, provided a referenced and standardised protocol for data acquisition and analysis is used.
Zusammenfassung in Deutsch
Voigt et al. (2021) zeigen in einer detaillierten Analyse Einschränkungen auf, die sich für die Bestimmung von Fledermausabundanz auf der Grundlage akustischer Erfassungen ergeben, und kommen zu dem Schluss, dass diese Einschränkungen keine zuverlässige Bewertung der an Windkraftanlagen versterbenden Fledermäuse erlauben. Wir argumentieren, dass in Experimenten validiert wurde, dass an der Gondel von Windenergieanlagen aufgezeichnete akustische Daten ein nützliches und geeignetes Maß für Fledermausschlagopfer sind. Daher können akustische Daten zur Abschätzung an Windenergieanlagen zu Tode kommender Fledermäuse verwendet werden, vorausgesetzt, es wird ein referenziertes und standardisiertes Protokoll für die Datenerfassung und ‐analyse verwendet.
Wind turbines cause bat mortality all over the world, thus effective curtailment strategies are crucial for bat conservation. A recent perspective suggested that technical, physical, and biological factors severely limit acoustic monitoring at wind turbines for evaluating fatalities of bats. We argue that standardised and referenced acoustic monitoring can reliably estimate fatalities of bats at wind turbines. Biases can be accounted for by correlating bat fatalities to the number of acoustic recordings in a large dataset from many turbines. Standardised detector measurements are then used to assess the level of bat activity and the resulting collisions, and to model relationships between environmental factors and bat activity at a specific turbine in order to predict future bat activity and to adapt wind turbine curtailment accordingly.
We have designed bispecific antibodies that bind one target (anti-Her3) in a bivalent IgG-like manner and contain one additional binding entity (anti-cMet) composed of one VH and one VL domain ...connected by a disulfide bond. The molecules are assembled by fusing a VH,Cys44 domain via flexible connector peptides to the C-terminus of one H-chain (heavy chain), and a VL,Cys100 to another H-chain. To ensure heterodimerization during expression in mammalian cells, we introduced complementary knobs-into-holes mutations into the different H-chains. The IgG-shaped trivalent molecules carry as third binding entity one disulfide-stabilized Fv (dsFv) without a linker between VH and VL. Tethering the VH and VL domains at the C-terminus of the CH3 domain decreases the on-rates of the dsFv to target antigens without affecting off-rates. Steric hindrance resolves upon removal of one side of the double connection by proteolysis: this improves flexibility and accessibility of the dsFv and fully restores antigen access and affinity. This technology has multiple applications: (i) in cases where single-chain linkers are not desired, dsFvs without linkers can be generated by addition of furin site(s) in the connector that are processed during expression within mammalian cells; (ii) highly active (toxic) entities which affect expression can be produced as inactive dsFvs and subsequently be activated (e.g. via PreScission cleavage) during purification; (iii) entities can be generated which are targeted by the unrestricted binding entity and can be activated by proteases in target tissues. For example, Her3-binding molecules containing linkers with recognition sequences for matrix metalloproteases or urokinase, whose inactivated cMet binding site is activated by proteolytic processing.
This study examines the effects of endurance training on red blood cells (RBC) in seventeen non-insulin-dependent type 2 diabetic men with a special focus on in vivo RBC aging. Venous blood was ...collected pre- and post-training at rest. RBC from whole blood and RBC separated according to cell age by density-gradient centrifugation were analyzed. RBC deformability was measured by ektacytometry. Immunohistochemical staining was performed to quantify the RBC-nitric oxide (NO) synthase activation (RBC-NOSSer1177) because RBC-NOS-produced NO can contribute to increased RBC deformability. The proportion of "young" RBC was significantly higher post-training. RBC deformability of all RBC (RBC of all ages) remained unaltered post-training. During RBC aging, RBC deformability decreased in both pre- and post-training. However, the training significantly increased RBC deformability in "young" and reduced their deformability in aging RBC. RBC-NOS activation remained unaltered in all RBC post-training. It tendentially increased in aging RBC pre-training, but did not change during aging post-training. The training significantly reduced RBC-NOS activation in "old" RBC. Endurance training may improve the RBC system (higher amount of "young" RBC which are more deformable). It remains speculative whether changes in older RBC (reduced RBC-NOS activation and deformability) could lead to more rapid elimination of aged RBC.
The multidrug resistance protein 5 (MRP5/ABCC5) has been recently identified as cellular export pump for cyclic nucleotides with 3′,5′-cyclic GMP (cGMP) as a high-affinity substrate. In view of the ...important role of cGMP for cardiovascular function, expression of this transport protein in human heart is of relevance. We analyzed the expression and localization of MRP5 in human heart 21 auricular (AS) and 15 left ventricular samples (LV) including 5 samples of dilated and ischemic cardiomyopathy. Quantitative real-time polymerase chain reaction normalized to β-actin revealed expression of the
MRP5
gene in all samples (LV, 38.5 ± 12.9; AS, 12.7 ± 5.6;
P
< 0.001). An MRP5-specific polyclonal antibody detected a glycoprotein of ∼190 kd in crude cell membrane fractions from these samples. Immunohistochemistry with the affinity-purified antibody revealed localization of MRP5 in cardiomyocytes as well as in cardiovascular endothelial and smooth muscle cells. Furthermore, we could detect MRP5 and ATP-dependent transport of
3HcGMP in sarcolemma vesicles of human heart. Quantitative analysis of the immunoblots indicated an interindividual variability with a higher expression of MRP5 in the ischemic (104 ± 38% of recombinant MRP5 standard) compared to normal ventricular samples (53 ± 36%,
P
< 0.05). In addition, we screened genomic DNA from our samples for 20 single-nucleotide polymorphisms in the
MRP5
gene. These results indicate that MRP5 is localized in cardiac and cardiovascular myocytes as well as endothelial cells with increased expression in ischemic cardiomyopathy. Therefore, MRP5-mediated cellular export may represent a novel, disease-dependent pathway for cGMP removal from cardiac cells.
We present a method to generate a flat (large horizontal to vertical emittance ratio) electron beam suitable for linear colliders. The concept is based on a round-beam rf photoinjector with finite ...solenoid field at the cathode together with a special beam optics adapter. Computer simulations of this new type of beam source show that the beam quality required for a linear collider may be obtainable without the need for an electron damping ring.
The photoproduction of η′-mesons off different nuclei has been measured with the CBELSA/TAPS detector system for incident photon energies between 1500–2200 MeV. The transparency ratio has been ...deduced and compared to theoretical calculations describing the propagation of η′-mesons in nuclei. The comparison indicates a width of the η′-meson of the order of Γ=15–25 MeV at ρ=ρ0 for an average momentum pη′=1050 MeV/c, at which the η′-meson is produced in the nuclear rest frame. The inelastic η′N cross section is estimated to be 3–10 mb. Parameterizing the photoproduction cross section of η′-mesons by σ(A)=σ0Aα, a value of α=0.84±0.03 has been deduced.
Transcription of the prostate-specific antigen (PSA) gene is androgen regulated. The PSA promoter contains at position â170
the sequence AGAACAgcaAGTGCT, which is closely related to the ARE ...(androgen response element) consensus sequence GGTACAnnnTGTTCT.
This sequence is a high affinity androgen receptor (AR) binding site and acts as a functional ARE in transfected LNCaP cells.
A 35-base pair segment starting at â400 (ARR: androgen response region; GTGGTGCAGGGATCAGGGAGTCTCACAATCTCCTG) cooperates with
the ARE in androgen induction of the PSA promoter. A construct with three ARR copies linked to a minimal PSA promoter showed
a strong (104-fold) androgen induced activity. The ARR was also able to confer androgen responsiveness to a minimal thymidine
kinase promoter. Both AR binding and transcriptional activity resided in a 20-base pair ARR subfragment: CAGGGATCAGGGAGTCTCAC
(2S). Mutational analysis indicated that the sequence GGATCAgggAGTCTC in the 2S fragment is a functionally active, low affinity
AR binding site. Like AR, the glucocorticoid receptor was able to stimulate PSA promoter activity. Both the ARE and ARR are
involved in dexamethasone regulation of the PSA promoter. Both the AR and glucocorticoid receptor were 20-100-fold more active
on ARR-PSA and ARR-thymidine kinase promoter constructs in LNCaP cells than in other cell types (COS, HeLa, Hep3B, and T47D
cells), indicating (prostate) cell specificity.
The physics program of
P̄ANDA covers a wide range of topics that address central issues of QCD. The
P̄ANDA detector will make use of the antiprotons produced in the
FAIR complex and stored in the ...high-energy synchrotron
HESR for the study of strong interactions in collisions with protons and heavy targets. Central to the program and defining the guidelines for the detector development are the spectroscopy of charmonium states and open charm with unprecedented quality, the search for exotic objects such as glueballs and hybrids, investigation of the modification of meson properties in medium, and copious production of hypernuclei for high-resolution spectroscopy. Technical developments for the various detector components are ongoing. The detector properties required in order to cover the broad physics program pose challenges which need state-of-the-art technology and customized solutions.
The objective examination of the Post-COVID syndrome (PCS) remains difficult due to heterogeneous definitions and clinical phenotypes. The aim of the study was to verify the functionality and ...correlates of a recently developed PCS score.
The PCS score was applied to the prospective, multi-center cross-sectoral cohort (in- and outpatients with SARS-CoV-2 infection) of the "National Pandemic Cohort Network (NAPKON, Germany)". Symptom assessment and patient-reported outcome measure questionnaires were analyzed at 3 and 12 months (3/12MFU) after diagnosis. Scores indicative of PCS severity were compared and correlated to demographic and clinical characteristics as well as quality of life (QoL, EQ-5D-5L).
Six hundred three patients (mean 54.0 years, 60.6% male, 82.0% hospitalized) were included. Among those, 35.7% (215) had no and 64.3% (388) had mild, moderate, or severe PCS. PCS severity groups differed considering sex and pre-existing respiratory diseases. 3MFU PCS worsened with clinical severity of acute infection (p = .011), and number of comorbidities (p = .004). PCS severity was associated with poor QoL at the 3MFU and 12MFU (p < .001).
The PCS score correlated with patients' QoL and demonstrated to be instructive for clinical characterization and stratification across health care settings. Further studies should critically address the high prevalence, clinical relevance, and the role of comorbidities.
The cohort is registered at www.
gov under NCT04768998.
In this study, we have analysed the apoptotic effects of the ubiquitous environmental toxin benzoapyrene (BP) in HaCaT cells and human keratinocytes. Although prolonged exposure to BP was not ...cytotoxic on its own, a strong enhancement of CD95 (Fas)-mediated apoptosis was observed with BP at concentrations activating the aryl hydrocarbon receptor (AhR). Importantly, the ultimately mutagenic BP-metabolite, that is, (+)-anti-BP-7,8-diol-9,10-epoxide (BPDE), failed to enhance CD95-mediated cell death, suggesting that the observed pro-apoptotic effect of BP is neither associated with DNA adducts nor DNA-damage related signalling. CD95-induced apoptosis was also enhanced by β-naphtoflavone, a well-known agonist of the AhR that does not induce DNA damage, thus suggesting a crucial role for AhR activation. Consistently, BP failed to sensitise for CD95L-induced apoptosis in AhR knockdown HaCaT cells. Furthermore, inhibition of CYP1A1 and/or 1B1 expression did not affect the pro-apoptotic crosstalk. Exposure to BP did not increase expression of CD95, but led to augmented activation of caspase-8. Enhancement of apoptosis was also observed with the TRAIL death receptors that activate caspase-8 and apoptosis by similar mechanisms as CD95. Together, these observations indicate an interference of AhR signalling with the activity of receptor-associated signalling intermediates that are shared by CD95 and TRAIL receptors. Our data thus suggest that AhR agonists can enhance cytokine-mediated adversity upon dermal exposure.
PDF
