In this paper, the light absorption in the active layer of polymer solar cells (OPV) by using plasmonic nanocrystals with a hexagonal lattice structure is investigated. To study the relationship ...between the performance of the OPV solar cell and its active layer, a three-dimensional model of its morphology is utilized. Therefore, the three-dimensional (3D) finite-difference time-domain method and Lumerical software were used to measure the field distribution and light absorption in the active layer in terms of wavelength. OPV solar cells with bilayer and bulk heterojunction structured cells were designed using hexagonal lattice crystals with plasmonic nanoparticles, as well as core–shell geometry to govern a design to optimize light trapping in the active layer. The parameters of shape, material, periodicity, size, and the thickness of the active layer as a function of wavelength in OPV solar cells have been investigated. A very thin active layer and an ultra-thin shell were used to achieve the highest increase in optical absorption. The strong alternating electromagnetic field around the core–shell plasmonic nanoparticles resulting from the localized surface plasmon resonance (LSPR) suggested by the Ag plasmonic nanocrystals increased the intrinsic optical absorption in the active layer poly(3-hexylthiophene):phenyl-C61-butyric acid methyl ester (P3HT:PCBM). Based on the photovoltaic results, the short circuit current ranged from 19.7 to 26.7 mA/cm
2
.
Abstract
Crimean-Congo hemorrhagic fever (CCHF) is an acute viral zoonotic disease. The widespread geographic distribution of the disease and the increase in the incidence of the disease from new ...regions, placed CCHF in a list of public health emergency contexts. The rapid diagnosis, in rural and remote areas where the majority of cases occur, is essential for patient management. Aptamers are considered as a specific and sensitive tool for being used in rapid diagnostic methods. The Nucleoprotein (NP) of the CCHF virus (CCHFV) was selected as the target for the isolation of aptamers based on its abundance and conservative structure, among other viral proteins. A total of 120 aptamers were obtained through 9 rounds of SELEX (Systematic Evolution of Ligands by Exponential Enrichment) from the ssDNA aptamer library, including the random 40-nucleotide ssDNA region between primer binding sites (GCCTGTTGTGAGCCTCCTAAC(N
40
)GGGAGACAAGAATAAGCA). The K
D
of aptamers was calculated using the SPR technique. The Apt33 with the highest affinity to NP was selected to design the aptamer-antibody ELASA test. It successfully detected CCHF NP in the concentration of 90 ng/ml in human serum. Evaluation of aptamer-antibody ELASA with clinical samples showed 100% specificity and sensitivity of the test. This simple, specific, and the sensitive assay can be used as a rapid and early diagnosis tool, as well as the use of this aptamer in point of care test near the patient. Our results suggest that the discovered aptamer can be used in various aptamer-based rapid diagnostic tests for the diagnosis of CCHF virus infection.
SARS-CoV-2, a newly emerging coronavirus that caused the COVID-19 epidemic, has been spreading quickly throughout the world. Despite immunization and some fairly effective therapeutic regimens, ...SARS-CoV-2 has been ravaging patients, health workers, and the economy. SARS-CoV-2 mutates and evolves to adapt to its host as a result of extreme selection pressure. As a consequence, new SARS-CoV-2 variants have emerged, some of which are classified as variants of concern (VOC) because they exhibit greater transmissibility, cause more-severe disease, are better able to escape immunity, or cause higher mortality than the original Wuhan strain. Here, we introduce these VOCs and review their characteristics, such as transmissibility, immune escape, mortality risk, and diagnostics.
Utilizing the finite difference time domain (FDTD) method, energy eigenvalues of spherical, cylindrical, pyramidal and cone-like quantum dots are calculated. To do this, by the imaginary time ...transformation, we transform the schrödinger equation into a diffusion equation. Then, the FDTD algorithm is hired to solve this equation. We calculate four lowest energy eigenvalues of these QDs and then compared the simulation results with analytical ones. Our results clearly show that simulation results are in very good agreement with analytical results. Therefore, we can use the FDTD method to find accurate results for the Schrödinger equation.
Graphical abstract
In this Paper,
YCa
2
Cu
3
O
7
superconductor composites were fabricated with biocompatible carbonate calcium nanoparticles. The effect of the biocompatible nanoparticle on YBCO superconductor ...properties were investigated. For this purpose, planetary ball milling process used to produce
CaCO
3
nanoparticles from cuttlebone (
Sepia pharaonis
) of the Persian Gulf. Then, samples of superconductor composite with the natural carbonate calcium were fabricated. The samples were prepared by solid state reaction method with mixing, calcination and sintering process. The samples were characterized and studied using dynamic light scattering technique, Meissner effect test, XRD analysis and FESEM imaging. The critical current density (
J
C
) and oxygen content of samples were measured by traditional four-probes method and iodometric titration method, respectively. The superconducting transition temperatures and
J
C
were determined 90.2 K and 28.4
A
/
cm
2
by four-probe method measurements, respectively. The results showed a significant enhancement of the superconducting
J
C
due to using the natural
CaCO
3
nanoparticles in the samples.
In this study, an experimental design was employed to optimize the fabrication of the
YCa
2
Cu
3
O
7
superconductor composite. The superconductors were fabricated using biocompatible calcium ...carbonate nanoparticles extracted from cuttlebone, Sepia pharaonis, of the Persian Gulf in the Bushehr coastal area, and their effects on
YCa
2
Cu
3
O
7
superconductor’s properties were investigated. Ball milling process and solid-state calcination reaction were used for obtaining the natural calcium carbonate nanoparticles and fabrication of the superconductors, respectively. The effects of three factors, milling time and the excess amount of the natural calcium carbonate as well as yttrium oxide, were investigated on the superconductivity properties of the products. The Taguchi statistical design of experiments was conducted to reveal the sensitivity analysis of the products’ properties due to the variation in each variable, finding optimal production conditions, and reduction in the total number of required experiments. In this method, the oxygen content of the fabricated superconductor was considered as the targeted
YCa
2
Cu
3
O
7
property. Moreover, the morphology and structural properties of the products were investigated to find the relationship between physicochemical properties and superconductivity. The
YCa
2
Cu
3
O
7
superconductors were characterized by the Meissner effect test, XRD analysis, and FESEM imaging. The sensitivity analysis was shown that by increasing milling time and the excess amount of the reactants in the solid-state reaction, the connectivity and crystallization of the grains were improved, and the optimum operating conditions for the production were achieved. Besides, the variation in milling time causes more signal-to-noise ratio, which indicates the highest efficacy of this factor on the superconductivity of the products in comparison with the other variables.
In the last two decades, researchers have attempted to use environmentally friendly pigments and porous nanostructures as sensitizers and semiconductors in dye-sensitized solar cells (DSSCs), ...respectively. In this study, the pigments were extracted from black plums (Syzygium cumini) to increase the biocompatibility of the DSSCs. The UV–vis spectroscopy of the extracted solution revealed the existence of anthocyanin pigments. The cyclic voltammetry measurement showed that the pigment energy levels were suitable for electron transfer to the TiO2 semiconductor, and the pigment electrochemical properties were also comparable with the commercial synthetic pigments. The dynamic light scattering experiment and zeta potential measurement illustrated that the size and electrostatic potential of the pigments were 0.3 nm and ±5 mV, respectively. These data confirmed the potential of the pigments for the diffusion into the porous structure of the TiO2 semiconductor and attraction as a shell layer on its surfaces. Besides, the TiO2 pastes were produced with seven different methods and characterized using XRD, SEM, and BET experiments. The results showed that the morphology, particle size, porosity, and surface area of the produced nanostructures were different in each method. Finally, the pastes were coated on the glass, sensitized with the extracted natural pigments, and used in the fabricated DSSCs. The efficiency of the cells was evaluated in the range of 0.027%–0.256% using the sun simulator technique. The results showed that the optimum particle size of the TiO2 semiconductor was around 25.6 nm which had been formed in the sixth method of the paste preparation.
•Localized surface plasmon excitations on a setting of two coupled gold nanoparticles as a nanoantennas were investigated.•MMP method is a good candidate, which is accurate, easy-to-handle, and very ...efficient even on a low-cost, state-of-the-art PC.•Tuning the physical parameters of the nanoantennas could enhance emitter radiation ranging from the UV to the near-IR spectrum.
We study localized surface plasmon excitations on a set of two coupled two-dimensional (2D) gold nanoparticles as a nanoantenna by using the multiple multipoles (MMP) method. We investigate the plasmon spectrum as a function of the nanoparticle's size, the background index of refraction, and the separating gap between the nanoparticles in order to provide proper means to tune the underlying plasmon resonance efficiently. Accurate multiple multipoles (MMP) computations are conducted with precise control over error measures, particularly for configurations of coupled particles with varying inter-particle distances and illumination conditions. Our findings demonstrate that by selecting these parameters carefully, nanoantennae can amplify emitter radiation across a wide range of spectra from ultraviolet to near-infrared. Numerical calculations have revealed that the MMP method is accurate, easy to handle, and efficient even on a low-cost, state-of-the-art PC.
COVID-19 immunity in infected individuals may not be persistent. The specific response wanes in patients who have recovered from this infection. Nevertheless, it has not been fully understood whether ...true re-infection occurs or the viral reactivation. In this study, we investigated three COVID-19 patients who represented the symptoms after recovery. Chest CT scan was applied to assess the patients along with the viral samples from oropharyngeal/nasopharyngeal which were subjected to RT-PCR. The viral genome sequencing was applied where possible to distinguish possible re-infection or latent reactivation. Moreover, COVID-19-specific antibodies available data were evaluated in each incidence. The second episode of SARS-CoV-2 infection was different among the investigated subjects who experienced an interval between positive PCR tests ranged between 63 and 156 days. The disease presentation was less or more severe in the second infection. All cases were found IgG positive in the re-infection phase. The sequencing of SARS-CoV-2 sample obtained from two cases revealed a D614G mutation of S gene from the second isolated sample strengthens the case for the re-infection. The possibility of re-infection and reactivation could have significant effect on clinical implications and also vaccination. Our data supports clear warning of SARS-CoV-2 continuous circulation potency among the populations in spite of herd immunity either with natural infection or vaccination. This issue is critical in term of the patients, clinical investigate, and viral transmission.
Objectives
Serotype 2 of dengue virus (DENV-2) is the most prevalent cause of dengue fevers. In this study, the C-prM gene was used for specific detection of DENV-2 by RT-LAMP assay. The RT-LAMP ...assay was optimized using the Taguchi design of experiments.
Results
The efficiency of the assay in such optimal conditions resulted in 100% sensitivity
,
100% specificity, and 100% overall accuracy for detection of 4 copies/μL of the genome of DENV-2. In addition, the detection of 2 copies/μL of the genome of DENV-2 was feasible, although the sensitivity was 50%. Considering the importance of the specific detection of the dengue virus serotypes, the cost-effective RT-LAMP approach can be used for rapid, specific, and sensitive detection of DENV-2.
Conclusion
RT-LAMP, as a cost-effective method, was optimized using Taguchi array approach for specific and rapid detection of DENV-2. Such methods can facilitate the diagnosis procedure in remote regions.
PDF
