Recently, the secondary use of by-products of the processing industry resulting from the production of poultry meat, which can be included in animal diets, has become a popular topic in the feed ...industry. For studying the effects of partial replacement of rapeseed cake (RC) with the by-product source of animal protein concentrate Agro-Matic (PCAM) on growth dynamics, nutrient absorption and nitrogen balance, as well as blood biochemical parameters during the growing period, a total of 48 Russian Ayrshire dairy heifers were selected for this experiment and they were divided into three experimental groups (16 in each group, including the control group). The heifers of the control group were fed the basal diet which contained rapeseed cake (30%), while the second (RC + PCAM) and third groups (PCAM + RC) were fed the basal diet after replacing a part of the rapeseed cake with 2.25% and 4.5% of protein concentrate Agro-Matic respectively. The results showed that the weight of heifers treated with PCAM at 3 months of age exceeded the control by 2.3 kg (p > 0.05) in group 2 by 4.4 kg (p < 0.05). Similar results were obtained at the age of 6 months of raising. Feeding 4.50% protein concentrate Agro-Matic has a positive effect on the digestibility of nutrients; in particular, there was a significant increase in the digestibility of crude protein in the PCAM + RC group (77.23 vs. 73.42%) compared with the control group. Moreover, a similar trend was found in the digestibility of nitrogen in the diet. At the age of 3 months, heifers showed a significant decrease in the concentration of ketone bodies in the second group (1.82 vs. 2.20 mmol/L) relative to the control group. Urea was significantly lower in the RC + PCAM group (5.05 vs. 6.62 mmol/L) relative to the PCAM + RC group, while acid capacity (alkaline reserve) was higher by 2.41% (p < 0.05) relative to the control. In the 10th month of age, a positive effect on the blood of heifers was observed, as in the second and the third experimental groups, β-globulin and phosphorus increased (p < 0.05), while in the second group aspartate aminotransferase decreased (p < 0.05). Consequently, replacing the rapeseed cake with the protein concentrate Agro-Matic revealed an improvement in the dynamics of growth, nutrient digestibility and nitrogen balance, and it has an effect on improving some biochemical parameters of the blood.
Abstract
Aims
Gut bacteria play an important role in poultry nutrition and the immune defense system. Changes in the intestinal microbiome affect the physiological state, metabolism, and innate ...immunity of poultry. The present study aimed to characterize age-related changes in the gastrointestinal tract microflora in broiler chickens, depending on supplementation of the diet with the in-feed antibiotic Stafac® 110 and a Bacillus subtilis strain-based probiotic.
Methods and results
In this regard, a comprehensive analysis of the taxonomic structure of the microbial community in the gastrointestinal tract (GIT) of broiler chickens was carried out using a molecular genetic technique of the terminal-restriction fragment length polymorphism analysis and taking into account age dynamics and feeding treatment. A beneficial effect on the microbiological composition and body weight of broilers was observed when using the antibiotic and probiotic in compound feeds. Different bacterial communities were revealed in the duodenum and cecum, and their positive impact on broiler growth was established. The results obtained shed light on the formation of GIT microflora of broiler chickens during the growing period and its changes in response to the use of the antibiotic and the probiotic.
Conclusions
We suggest that the implementation of the tested in-feed antibiotic and probiotic can be beneficial in regulating the intestinal microflora microbiological processes in the GIT and improving the feeding efficiency and productivity of broiler chickens.
Many of the World's studies are aimed at identifying specific microbial markers of chicken intestines, including those markers that are associated with diseases. While mycotoxins can lead to ...bacterial disorder, gut microbiota could play a useful role in the prevention of mycotoxicosis. For this reason, it is important to characterize the bacterial populations that are involved in the dysbacteriosis caused by mycotoxins. This study was aimed the influence of diet contaminated with T‐2 toxin on caecum microbiome of Smena‐8 broilers. The experiment was carried out on 33‐day‐old broiler chickens for 14 days according to the Basic Principles of the Declaration of Helsinki. 4 experimental groups (5 chickens in each) were formed based on the concentration of the added T‐2 toxin: control 1, that received a diet without the contamination of T‐2 toxin, trial 2 ‐ received a diet with the addition of T‐2 toxin at a concentration of 100 μg/kg, trial 3 ‐ 200 μg/kg, trial 3 ‐ 400 μg/kg. Broiler chicken caecal content's genomic DNA was extracted and amplified of 16S rRNA NGS sequencing by the Miseq sequencer (Illumina, USA). The results showed that some microorganisms, in comparison with the control group, completely disappeared, and some, on the contrary, appeared when the feed was contaminated with T‐2 toxin. Members of the Mycoplasmataceae family and the phylum Candidatus Saccharibacteria have appeared in the intestines of chickens in trials 2,3 and 4. The average number of representatives of the Mycoplasmataceaefamily, among which pathogens are often found, increased (P≤0.05) under the influence of the toxin. The number of the Mycoplasmataceae family in groups in trial 2,3,4 was 0.0063 ± 0.0003, 0.0093 ± 0.0005 and 0.0130 ± 0.0007% respectively. On the contrary, representatives of other families (including Anaerolineaceae, Rickettsiaceae, Neisseriaceae), which are found in the control, completely disappeared from the intestines of chickens when contaminated with T‐2 toxin (trials 2,3 and 4). Thus, it can be concluded that T‐2 toxin provokes dysbiosis in the intestines of chickens. The number of the Lactobacillaceaefamily increased depending on the increase in the dose of mycotoxin – in trials 2,3 and 4 it was higher than in controls by 31.6, 45.6 and 46.3%, respectively. In all likelihood, lactobacilli are more resistant to mycotoxins than other members of the microbiota. This may be due to the fact that Lactobacillaceaemay play a role in the mycotoxin detoxification process. We believe that Lactobacillaceae, Mycoplasmataceae, Candidatus Saccharibacteria, Anaerolineaceae, Rickettsiaceae, Neisseriaceae are indicator groups of microorganisms that could be relevant biomarkers of toxicity of T‐2 toxin in chickens.
Reindeer are unique arctic ruminants. They exist in conditions of extremely poor nutrition; therefore, the processes occurring in the rumen are of great scientific interest. It is known that the ...formation of lactate in the rumen is a key mechanism of metabolic disorders in the body of ruminants. Therefore, the aim of our study was to study the difference in the expression of two isomers of lactate dehydrogenases in the rumen of reindeer and to assess the level of enzymes depending on the sex and age of the animals.
To assess the differences in the formation of lactate by microorganisms of the rumen community of reindeer in the summer‐autumn period, we carried out a transcriptomic analysis of the D and L genes of lactate dehydrogenases. For this, 12 samples were taken to isolate RNA from females (vazhenki), males (choirs), and calves of rumen fluid from deer in the summer‐autumn period in the Nenets Autonomous District. Relative expression was calculated using the 2 ‐∆∆Ct method. The 16SrRNA gene was chosen as a reference gene. Primers for L‐lactate dehydrogenase: F: CATCAAAAAGTTGTGTTAGTCGGCG, R: TCAGCTAAACCGTCGTTAAGCACTT. Primers for D‐lactate dehydrogenase: F: CTGGGATCCGTTGAGGGAGATGCTTAAG, R: CCGAAGCTTTTAGTTGACCCGGTTGAC.
As a result of our work, we identified differences in the expression of lactate dehydrogenase genes between male and female reindeer. In males, a lower level of expression of genes of lactate dehydrogenases L and D types in the rumen was noted in comparison with females. It was 10 times less than that in the female rumen (p = 0.002 for L‐ldh, p = 0.001 for D‐ldh). Calves also showed higher levels of expression of these two genes compared to adult animals. The expression level of L‐ldh in the rumen of calves was 3 times higher than in adult animals (p = 0.03), and D‐ldh was two times less than in adult animals (p = 0.04). Lactic acid is formed as a result of lactic acid fermentation under the action of two different forms of lactate dehydrogenases: one of them (EC 1.1.1.27) produces the isomer L (+) ‐ lactate L‐lactate dehydrogenase, and the other (EC 1.1.1.28) produces the isomer D (‐) ‐ lactate D‐lactate dehydrogenase. The synthesized optical isomers have significant differences. These differences are essential for the normal physiological state of the animal, since the isomers differ in their ability to be excreted by the kidneys. D‐lactate has a lower excretion capacity and this determines its role in provoking metabolic acidosis. In addition, the genes of two isomers of lactate dehydrogenases are capable of performing the function of biological markers for the activity of the processes of lactic acid synthesis in the rumen of ruminants. In our study, females had a higher level of expression of both types of lactate dehydrogenases compared to males. Consequently, females may be more susceptible to associated metabolic disorders such as acidosis.
This study was performed to investigate the differential expression of eight immunity genes and the bacterial profiles in the caecum of growing chickens challenged with
serovar Enteritidis (SE) at 1 ...and 23 days post inoculation (dpi) in response to SE infection at 19 days of age and administration of the phytobiotic Intebio. Following infection, the genes
and
were upregulated by greater than twofold. Chicks fed Intebio showed at 1 dpi upregulation of
,
,
,
and
. At 23 dpi, expression of
,
,
,
and
lowered in the experiment subgroups as compared with the control. Examination of the caecal contents at 1 dpi demonstrated a significant decrease in the microbial biodiversity in the infected subgroup fed normal diet. Bacterial content of
and
declined, while that of
rose. In the infected subgroup fed Intebio, a pronounced change in composition of the microflora was not observed. In the early infection stages, the phytobiotic seemed to promote response to infection. Subsequently, an earlier suppression of the inflammatory reaction took place in chickens fed Intebio. Thus, use of Intebio as a drug with phytobiotic activity in chickens, including those infected with
, proved to be promising.
One of the main roles in poultry resistance to infections caused by
is attributed to host immunity and intestinal microbiota. We conducted an experiment that involved challenging Lohmann White laying ...hens with
Enteritidis (SE), feeding them a diet supplemented with an EOs-based phytobiotic Intebio
. At 1 and 7 days post-inoculation, the expression profiles of eight genes related to immunity, transport of nutrients in the intestine, and metabolism were examined. Cecal microbiome composition and blood biochemical/immunological indices were also explored and egg production traits recorded. As a result, the SE challenge of laying hens and Intebio
administration had either a suppressive or activating effect on the expression level of the studied genes (e.g.,
and
), the latter echoing mammalian/human tissue-specific expression. There were also effects of the pathogen challenge and phytobiotic intake on the cecal microbiome profiles and blood biochemical/immunological parameters, including those reflecting the activity of the birds' immune systems (e.g., serum bactericidal activity, β-lysine content, and immunoglobulin levels). Significant differences between control and experimental subgroups in egg performance traits (i.e., egg weight/number/mass) were also found. The phytobiotic administration suggested a positive effect on the welfare and productivity of poultry.
Although the herbicide glyphosate is widely used globally and considered safe, more evidence of its adverse effects on animals and humans is accumulating. The present investigation was aimed at ...evaluating the impact of different glyphosate concentrations on zootechnical characteristics and clinical, biochemical and immunological blood parameters in Ross 308 broiler chickens. Four groups were employed, including untreated control and three experimental groups fed diets enriched with glyphosate at doses of 10, 20 and 100 ppm that conformed to 0.5, 1 and 5 maximum residue limits, respectively. The results showed that glyphosate is a stress factor triggering a multifaceted effect on important blood parameters (e.g., white blood cell and phagocytic counts), which was shown for the first time in the experiments involving productive meat-type poultry. It was first revealed that glyphosate-induced changes in blood parameters may be related to a negative impact on the zootechnical characteristics including the digestive tract organ development and body weight gain. The study findings suggested that exposure to glyphosate in the feedstuffs can adversely affect the physiological condition and productivity of broilers.
The reindeer (
L.) is a unique animal inhabitant of arctic regions. Low ambient temperatures and scant diets (primarily, lichens) have resulted in different evolutional adaptations, including the ...composition of the ruminal microbiota. In the study presented here, the effects of seasonal and regional aspects of the composition of the ruminal microbiota in reindeer (Nenets breed, 38 animals) were studied (wooded tundra from the Yamalo-Nenetski Autonomous District (YNAD) vs. from the Nenetski Autonomous District (NAD)). The ruminal content of calves (
= 12) and adult animals (
= 26, 15 males and 11 females) was sampled in the summer (
= 16) and winter seasons (
= 22). The composition of the ruminal microbial population was determined by the V3-V4 16S rRNA gene region sequencing. It was found that the population was dominated by Bacteroidetes and Firmicutes phyla, followed by
and
. An analysis of the community using non-metric multidimensional scaling and Bray-Curtis similarity metrics provided evidence that the most influential factors affecting the composition of ruminal microbiota are the region (
= 0.001) and season (
= 0.001); heat map analysis revealed several communities that are strongly affected by these two factors. In the summer season, the following communities were significantly larger compared to in the winter season:
,
, and
. The following communities were significantly larger in the winter season compared to in summer:
,
spp.,
spp.,
spp.,
spp., and
spp. In NAD (tundra), the following communities were significantly larger in comparison to YNAD (wooded tundra):
(Verruco-5),
, PeHg47
, cellulolytic
, and
spp. The following bacterial groups were significantly larger in YNAD in comparison to NAD: cellulolytic
,
,
, and
spp. The significant differences in the ruminal microbial population were primarily related to the ingredients of diets, affected by region and season. The summer-related increases in the communities of certain pathogens (
,
spp.,
) were found. Regional differences were primarily related to the ratio of the species involved in ruminal cellulose degradation and ruminal fatty acids metabolism; these differences reflect the regional dissimilarities in botanical diet ingredients.
Animal feeding research has revealed a close relationship between the chemical composition and nutritional value of cow rations, the number of rumen bacterial communities and animal productivity. Our ...present research aimed to investigate the outcome of inclusion of different levels of protein concentrate in rations of Ayrshire dairy cows in relation to the rumen microbiome, reproductive traits and economic value. Forty-five Ayrshire cows were divided into three groups (15 in each). The first control group 0 AM was fed the basal ration, while the second 1 AM and third 2 AM groups were fed the basic ration with the sunflower cake replaced by different levels of protein concentrate Agro-Matic (1 and 1.5 kg/head/day, respectively). Ruminal fluid samples, reproductive parameters and economic value were studied. During the early lactation period, 120 days in milk (DIM), the number of pathogenic microorganisms decreased in both the 1 AM and 2 AM groups when compared with the control group 0 AM; moreover, a significant decrease in Peptococcus bacteria was recorded in the 1 AM group, while Fusobacterium decreased in the 2 AM group. At the end of lactation, the total number of cellulolytic bacteria increased with the use of protein concentrate in animals of the 1 AM group when compared with the control group. Regarding undesirable bacteria, the 2 AM group recorded the highest value for Lactobacilli and Actinobacteria when compared with the 0 AM group (0.18 and 8.90 vs. 0.04 and 4.24), and the differences were significant (p < 0.05). The insemination index and the duration of the days open period decreased in the 2 AM group, while the differences were p > 0.05. The profitability of milk production increased by 2.76% and 6.28% in both supplemented groups, and the differences compared to the 0 AM group were significant. We conclude that the supplementation of Agro-Matic caused no deviations from the normal standards of cellulolytic, amylolytic, transit and pathogenic bacteria, no impact on reproductive functions and significantly improved the profitability of the milk production process of Ayrshire dairy cows.
Purpose. To study the effect of the experimental microbiological preparation “Naturost”, created on the basis of Bacillus subtilis No. 111, on the growth and productivity of barley in the Vologda ...region. Materials and methods. The research was carried out during the growing seasons of 2019, 2020 and 2022 at the experimental field of RAS Vologda Research Center and under production conditions in the fields of the agricultural production cooperative (collective farm) “Plemzavod Prigorodnyi” (Vologda region). The preparation “Naturost” was introduced twice: while soaking the seeds and spraying the phyllosphere of the plants in the tillering phase. Whole-genome sequencing of the strain of the bacterium B. subtilis-111 was carried out at the molecular genetic laboratory of “Biotrof” company with the use of MiSeq platform (Illumina, Inc.) Results. During the whole-genome sequencing of B. subtilis-111 strains, it was found that it has auxin biosynthesis genes; a range of various protective mechanisms contributing to the survival of the strain in the natural environment was also detected in the genome. In addition, the genome of the strain contains an array of groups of genes that are responsible for the production of bacteriocins with pronounced antimicrobial activity. The treatment of barley plants with the experimental preparation “Naturost” contributed to an increase in the growth parameters of the crop: dry mass increased to 33%, average daily increments – up to 48%, which occurred against the background of an increase in the content of photosynthetic pigments. Grain productivity in the conditions of small-scale experiments with the use of the preparation increased by 7–19%, and in the actual field conditions – by 14% relative to the control. Conclusion. The experimental preparation based on B. subtilis-111 had a stimulating effect on the growth and productivity of barley of the breed Sonet in the Vologda region.
PDF
