Abstract
Aims
Gut bacteria play an important role in poultry nutrition and the immune defense system. Changes in the intestinal microbiome affect the physiological state, metabolism, and innate ...immunity of poultry. The present study aimed to characterize age-related changes in the gastrointestinal tract microflora in broiler chickens, depending on supplementation of the diet with the in-feed antibiotic Stafac® 110 and a Bacillus subtilis strain-based probiotic.
Methods and results
In this regard, a comprehensive analysis of the taxonomic structure of the microbial community in the gastrointestinal tract (GIT) of broiler chickens was carried out using a molecular genetic technique of the terminal-restriction fragment length polymorphism analysis and taking into account age dynamics and feeding treatment. A beneficial effect on the microbiological composition and body weight of broilers was observed when using the antibiotic and probiotic in compound feeds. Different bacterial communities were revealed in the duodenum and cecum, and their positive impact on broiler growth was established. The results obtained shed light on the formation of GIT microflora of broiler chickens during the growing period and its changes in response to the use of the antibiotic and the probiotic.
Conclusions
We suggest that the implementation of the tested in-feed antibiotic and probiotic can be beneficial in regulating the intestinal microflora microbiological processes in the GIT and improving the feeding efficiency and productivity of broiler chickens.
Drilling and submersible studies of the Atlantis Bank (Southwest Indian Ridge) and the Atlantis Massif (Mid‐Atlantic Ridge) oceanic core complexes reveal “gabbro‐localized” and “peridotite‐localized” ...end‐member models of strain localization and deformation during core complex development, in which the gabbroic fault rocks exhibit extensive and rare high‐temperature ductile‐deformation fabrics, respectively. Both models emphasize a footwall cored by gabbroic intrusions, therefore precluding an amagmatic origin of core complex formation. We test these models by using relict oceanic core complexes preserved in the western Mirdita Ophiolite in Albania. The Puka and Krabbi massifs display traits of the peridotite‐localized detachment model, whereby amagmatic tectonic extension is not required for the formation of this category of core complexes.
Many of the World's studies are aimed at identifying specific microbial markers of chicken intestines, including those markers that are associated with diseases. While mycotoxins can lead to ...bacterial disorder, gut microbiota could play a useful role in the prevention of mycotoxicosis. For this reason, it is important to characterize the bacterial populations that are involved in the dysbacteriosis caused by mycotoxins. This study was aimed the influence of diet contaminated with T‐2 toxin on caecum microbiome of Smena‐8 broilers. The experiment was carried out on 33‐day‐old broiler chickens for 14 days according to the Basic Principles of the Declaration of Helsinki. 4 experimental groups (5 chickens in each) were formed based on the concentration of the added T‐2 toxin: control 1, that received a diet without the contamination of T‐2 toxin, trial 2 ‐ received a diet with the addition of T‐2 toxin at a concentration of 100 μg/kg, trial 3 ‐ 200 μg/kg, trial 3 ‐ 400 μg/kg. Broiler chicken caecal content's genomic DNA was extracted and amplified of 16S rRNA NGS sequencing by the Miseq sequencer (Illumina, USA). The results showed that some microorganisms, in comparison with the control group, completely disappeared, and some, on the contrary, appeared when the feed was contaminated with T‐2 toxin. Members of the Mycoplasmataceae family and the phylum Candidatus Saccharibacteria have appeared in the intestines of chickens in trials 2,3 and 4. The average number of representatives of the Mycoplasmataceaefamily, among which pathogens are often found, increased (P≤0.05) under the influence of the toxin. The number of the Mycoplasmataceae family in groups in trial 2,3,4 was 0.0063 ± 0.0003, 0.0093 ± 0.0005 and 0.0130 ± 0.0007% respectively. On the contrary, representatives of other families (including Anaerolineaceae, Rickettsiaceae, Neisseriaceae), which are found in the control, completely disappeared from the intestines of chickens when contaminated with T‐2 toxin (trials 2,3 and 4). Thus, it can be concluded that T‐2 toxin provokes dysbiosis in the intestines of chickens. The number of the Lactobacillaceaefamily increased depending on the increase in the dose of mycotoxin – in trials 2,3 and 4 it was higher than in controls by 31.6, 45.6 and 46.3%, respectively. In all likelihood, lactobacilli are more resistant to mycotoxins than other members of the microbiota. This may be due to the fact that Lactobacillaceaemay play a role in the mycotoxin detoxification process. We believe that Lactobacillaceae, Mycoplasmataceae, Candidatus Saccharibacteria, Anaerolineaceae, Rickettsiaceae, Neisseriaceae are indicator groups of microorganisms that could be relevant biomarkers of toxicity of T‐2 toxin in chickens.
Reindeer are unique arctic ruminants. They exist in conditions of extremely poor nutrition; therefore, the processes occurring in the rumen are of great scientific interest. It is known that the ...formation of lactate in the rumen is a key mechanism of metabolic disorders in the body of ruminants. Therefore, the aim of our study was to study the difference in the expression of two isomers of lactate dehydrogenases in the rumen of reindeer and to assess the level of enzymes depending on the sex and age of the animals.
To assess the differences in the formation of lactate by microorganisms of the rumen community of reindeer in the summer‐autumn period, we carried out a transcriptomic analysis of the D and L genes of lactate dehydrogenases. For this, 12 samples were taken to isolate RNA from females (vazhenki), males (choirs), and calves of rumen fluid from deer in the summer‐autumn period in the Nenets Autonomous District. Relative expression was calculated using the 2 ‐∆∆Ct method. The 16SrRNA gene was chosen as a reference gene. Primers for L‐lactate dehydrogenase: F: CATCAAAAAGTTGTGTTAGTCGGCG, R: TCAGCTAAACCGTCGTTAAGCACTT. Primers for D‐lactate dehydrogenase: F: CTGGGATCCGTTGAGGGAGATGCTTAAG, R: CCGAAGCTTTTAGTTGACCCGGTTGAC.
As a result of our work, we identified differences in the expression of lactate dehydrogenase genes between male and female reindeer. In males, a lower level of expression of genes of lactate dehydrogenases L and D types in the rumen was noted in comparison with females. It was 10 times less than that in the female rumen (p = 0.002 for L‐ldh, p = 0.001 for D‐ldh). Calves also showed higher levels of expression of these two genes compared to adult animals. The expression level of L‐ldh in the rumen of calves was 3 times higher than in adult animals (p = 0.03), and D‐ldh was two times less than in adult animals (p = 0.04). Lactic acid is formed as a result of lactic acid fermentation under the action of two different forms of lactate dehydrogenases: one of them (EC 1.1.1.27) produces the isomer L (+) ‐ lactate L‐lactate dehydrogenase, and the other (EC 1.1.1.28) produces the isomer D (‐) ‐ lactate D‐lactate dehydrogenase. The synthesized optical isomers have significant differences. These differences are essential for the normal physiological state of the animal, since the isomers differ in their ability to be excreted by the kidneys. D‐lactate has a lower excretion capacity and this determines its role in provoking metabolic acidosis. In addition, the genes of two isomers of lactate dehydrogenases are capable of performing the function of biological markers for the activity of the processes of lactic acid synthesis in the rumen of ruminants. In our study, females had a higher level of expression of both types of lactate dehydrogenases compared to males. Consequently, females may be more susceptible to associated metabolic disorders such as acidosis.
One of the main roles in poultry resistance to infections caused by
is attributed to host immunity and intestinal microbiota. We conducted an experiment that involved challenging Lohmann White laying ...hens with
Enteritidis (SE), feeding them a diet supplemented with an EOs-based phytobiotic Intebio
. At 1 and 7 days post-inoculation, the expression profiles of eight genes related to immunity, transport of nutrients in the intestine, and metabolism were examined. Cecal microbiome composition and blood biochemical/immunological indices were also explored and egg production traits recorded. As a result, the SE challenge of laying hens and Intebio
administration had either a suppressive or activating effect on the expression level of the studied genes (e.g.,
and
), the latter echoing mammalian/human tissue-specific expression. There were also effects of the pathogen challenge and phytobiotic intake on the cecal microbiome profiles and blood biochemical/immunological parameters, including those reflecting the activity of the birds' immune systems (e.g., serum bactericidal activity, β-lysine content, and immunoglobulin levels). Significant differences between control and experimental subgroups in egg performance traits (i.e., egg weight/number/mass) were also found. The phytobiotic administration suggested a positive effect on the welfare and productivity of poultry.
Although the herbicide glyphosate is widely used globally and considered safe, more evidence of its adverse effects on animals and humans is accumulating. The present investigation was aimed at ...evaluating the impact of different glyphosate concentrations on zootechnical characteristics and clinical, biochemical and immunological blood parameters in Ross 308 broiler chickens. Four groups were employed, including untreated control and three experimental groups fed diets enriched with glyphosate at doses of 10, 20 and 100 ppm that conformed to 0.5, 1 and 5 maximum residue limits, respectively. The results showed that glyphosate is a stress factor triggering a multifaceted effect on important blood parameters (e.g., white blood cell and phagocytic counts), which was shown for the first time in the experiments involving productive meat-type poultry. It was first revealed that glyphosate-induced changes in blood parameters may be related to a negative impact on the zootechnical characteristics including the digestive tract organ development and body weight gain. The study findings suggested that exposure to glyphosate in the feedstuffs can adversely affect the physiological condition and productivity of broilers.
The purpose of this research is to develop and test a new approach to prevent clostridial disease in cattle, based on the use of a new compound biologically active feed additive (BFA). Some ...properties of the separate components of BFA are characterized. The research showed that a strain of the bacterium Bacillus amyloliquefaciens159 has an expressed antagonism to toxin-producing strains of C. perfringens. When using the test strains of C. perfringens from the ATCC collection (13,124 as type A, 10,543 as type C, 12,916 as type F), the anticlostridial activity of the tested strains varied, with size range of 14.0 ± 0.95–15.0 ± 1.28 mm of delayed growth zones. The bactericidal properties of lauric acid and the sorption properties of diatomaceous earth, included in BFA, were confirmed. The experiment was conducted on Holstein cows at the beginning of lactation (control, C (n = 15) vs. experimental E48 (n = 15), E80 (n = 15) and E112 (n = 15), 48, 80 and 112 g/head/day BFA, respectively. All cows were vaccinated with “Coglavax” (vaccine against bovine and sheep clostridial disease, Ceva-Phylaxia VeterinaryBiologicals, Hungary), reinjected two weeks before the experiment. At the end of the experiment (3.5 months after the vaccination and 3 months after the start of BFA feeding according to the scheme of the experiment), the immune response in the control and Group E48 to C. perfringens β-toxin remained at the initial level, while the response in Group E80 and Group E112 became higher under the influence of BFA feeding. Cows fed BFA saw a guaranteed improvement in non-specific resistance. The increase in serum lysozyme concentration in cows of Groups E was 1.01–2.91 mkg/mL vs. control (p < 0.001). TP, GLB, ALB/GLB vs. Groups C and E48 (p < 0.001); this stabilized and normalized while feeding Group E80 and E112 animals with BFA. They also had improved nitrogen, fat, mineral metabolism, as indicated by significant increase in ALB (p < 0.05), UREA (p < 0.01), CHOL (p < 0.01), and CHL (p < 0.01) vs. Groups C and E48. Consumption of BFA increased the amount of anti-oxidants in the blood (highest TAWSA values in Group E80 14.45 mg/g, p = 0.002). Serum TBA–AP/ CP ratio was directly related to TBA–AP (r = 0.87, p < 0.001), and decreased in Group E80. The milk productivity increased under the action of BFA; the average daily milk yield of the cows from the experimental groups for the period of the experiment (d0–d98) was 1.24–1.66 kg higher than that of the control. At the same time, Group E112 cows had a significant increase in milk yield (by 5.1%, p = 0.03 vs. Control). Thus, feeding BFA to dairy cows was found to improve resistance, prevent toxicoses and increase milk production of cattle, which can serve as an additional strategy for bioprotection of cattle against infection.
This study was performed to investigate the differential expression of eight immunity genes and the bacterial profiles in the caecum of growing chickens challenged with
serovar Enteritidis (SE) at 1 ...and 23 days post inoculation (dpi) in response to SE infection at 19 days of age and administration of the phytobiotic Intebio. Following infection, the genes
and
were upregulated by greater than twofold. Chicks fed Intebio showed at 1 dpi upregulation of
,
,
,
and
. At 23 dpi, expression of
,
,
,
and
lowered in the experiment subgroups as compared with the control. Examination of the caecal contents at 1 dpi demonstrated a significant decrease in the microbial biodiversity in the infected subgroup fed normal diet. Bacterial content of
and
declined, while that of
rose. In the infected subgroup fed Intebio, a pronounced change in composition of the microflora was not observed. In the early infection stages, the phytobiotic seemed to promote response to infection. Subsequently, an earlier suppression of the inflammatory reaction took place in chickens fed Intebio. Thus, use of Intebio as a drug with phytobiotic activity in chickens, including those infected with
, proved to be promising.
Practice of layer poultry farming and commercial egg production relies on the optimal use and improvement of the welfare and genetically determined functional abilities of laying hens, their ...efficient intake of feed and its components, adaptation to housing conditions and resistance to infectious diseases including salmonellosis. Previous studies were focussed on relationships of chicken performance and resistance with the expression profiles of individual genes involved in metabolic processes and immune system, or with genetic markers that can be closely associated with these processes in chickens. In this study, mathematical models of coherent changes in laying hens were developed for the expression of eight genes involved in immunity and metabolism, on the one hand, and biochemical and immunological blood parameters, on the other hand, in response to Salmonella infection and administration of a phytobiotic Intebio. The proposed modelling approach can be a further basis for an in-depth research of the relationship between the gene expression, functional state and welfare of poultry, impact of pathogenic microorganisms and use of immunomodulatory drugs.
HIGHLIGHTS
Improved egg production and resistance rely on hens' potential in gene expression and metabolism.
We developed mathematical models for coherent responses of hens' gene expression and blood indices to Salmonella infection and phytobiotic intake.
This approach can be used for further studying relationship between gene expression, functional state, impact of pathogens and antimicrobial drugs.
The reindeer (
L.) is a unique animal inhabitant of arctic regions. Low ambient temperatures and scant diets (primarily, lichens) have resulted in different evolutional adaptations, including the ...composition of the ruminal microbiota. In the study presented here, the effects of seasonal and regional aspects of the composition of the ruminal microbiota in reindeer (Nenets breed, 38 animals) were studied (wooded tundra from the Yamalo-Nenetski Autonomous District (YNAD) vs. from the Nenetski Autonomous District (NAD)). The ruminal content of calves (
= 12) and adult animals (
= 26, 15 males and 11 females) was sampled in the summer (
= 16) and winter seasons (
= 22). The composition of the ruminal microbial population was determined by the V3-V4 16S rRNA gene region sequencing. It was found that the population was dominated by Bacteroidetes and Firmicutes phyla, followed by
and
. An analysis of the community using non-metric multidimensional scaling and Bray-Curtis similarity metrics provided evidence that the most influential factors affecting the composition of ruminal microbiota are the region (
= 0.001) and season (
= 0.001); heat map analysis revealed several communities that are strongly affected by these two factors. In the summer season, the following communities were significantly larger compared to in the winter season:
,
, and
. The following communities were significantly larger in the winter season compared to in summer:
,
spp.,
spp.,
spp.,
spp., and
spp. In NAD (tundra), the following communities were significantly larger in comparison to YNAD (wooded tundra):
(Verruco-5),
, PeHg47
, cellulolytic
, and
spp. The following bacterial groups were significantly larger in YNAD in comparison to NAD: cellulolytic
,
,
, and
spp. The significant differences in the ruminal microbial population were primarily related to the ingredients of diets, affected by region and season. The summer-related increases in the communities of certain pathogens (
,
spp.,
) were found. Regional differences were primarily related to the ratio of the species involved in ruminal cellulose degradation and ruminal fatty acids metabolism; these differences reflect the regional dissimilarities in botanical diet ingredients.
PDF
