Sodium‐ion hybrid supercapacitors (Na‐HSCs) have potential for mid‐ to large‐scale energy storage applications because of their high energy/power densities, long cycle life, and the low cost of ...sodium. However, one of the obstacles to developing Na‐HSCs is the imbalance of kinetics from different charge storage mechanisms between the sluggish faradaic anode and the rapid non‐faradaic capacitive cathode. Thus, to develop high‐power Na‐HSC anode materials, this paper presents the facile synthesis of nanocomposites comprising Nb2O5@Carbon core–shell nanoparticles (Nb2O5@C NPs) and reduced graphene oxide (rGO), and an analysis of their electrochemical performance with respect to various weight ratios of Nb2O5@C NPs to rGO (e.g., Nb2O5@C, Nb2O5@C/rGO‐70, ‐50, and ‐30). In a Na half‐cell configuration, the Nb2O5@C/rGO‐50 shows highly reversible capacity of ≈285 mA h g−1 at 0.025 A g−1 in the potential range of 0.01–3.0 V (vs Na/Na+). In addition, the Na‐HSC using the Nb2O5@C/rGO‐50 anode and activated carbon (MSP‐20) cathode delivers high energy/power densities (≈76 W h kg−1 and ≈20 800 W kg−1) with a stable cycle life in the potential range of 1.0–4.3 V. The energy and power densities of the Na‐HSC developed in this study are higher than those of similar Li‐ and Na‐HSCs previously reported.
Nb2O5@Carbon core–shell nanoparticles and reduced graphene oxide nanocomposites (Nb2O5@C/rGO) for new energy storage systems, namely sodium‐ion hybrid supercapacitors (Na‐HSCs), are presented. A Na‐HSC system comprising an Nb2O5@C/rGO anode and an MSP‐20 cathode delivers high energy and power densities (≈76 W h kg−1 and ≈20 800 W kg−1), with excellent cycling stability.
Golden bristlegrass‐like unique nanostructures comprising reduced graphene oxide (rGO) matrixed nanofibers entangled with bamboo‐like N‐doped carbon nanotubes (CNTs) containing CoSe2 nanocrystals at ...each node (denoted as N‐CNT/rGO/CoSe2 NF) are designed as anodes for high‐rate sodium‐ion batteries (SIBs). Bamboo‐like N‐doped CNTs (N‐CNTs) are successfully generated on the rGO matrixed nanofiber surface, between rGO sheets and mesopores, and interconnected chemically with homogeneously distributed rGO sheets. The defects in the N‐CNTs formed by a simple etching process allow the complete phase conversion of Co into CoSe2 through the efficient penetration of H2Se gas inside the CNT walls. The N‐CNTs bridge the vertical defects for electron transfer in the rGO sheet layers and increase the distance between the rGO sheets during cycles. The discharge capacity of N‐CNT/rGO/CoSe2 NF after the 10 000th cycle at an extremely high current density of 10 A g−1 is 264 mA h g−1, and the capacity retention measured at the 100th cycle is 89%. N‐CNT/rGO/CoSe2 NF has final discharge capacities of 395, 363, 328, 304, 283, 263, 246, 223, 197, 171, and 151 mA h g−1 at current densities of 1, 2, 4, 6, 8, 10, 12, 14, 16, 18, and 20 A g−1, respectively.
As high‐performance anodes for sodium‐ion batteries, golden bristlegrass‐like graphene nanofibers entangled with N‐doped CNTs containing CoSe2 nanocrystals are designed and synthesized. The synthesized unique nanostructure exhibits high cycling and rate performances even at extremely high current densities. The synergistic effect of the golden bristlegrass‐like unique structure and the N‐doped CNTs/graphene composite results in efficient anode materials for sodium‐ion batteries.
A general method to synthesize mesoporous metal oxide@N‐doped macroporous graphene composite by heat‐treatment of electrostatically co‐assembled amine‐functionalized mesoporous silica/metal oxide ...composite and graphene oxide, and subsequent silica removal to produce mesoporous metal oxide and N‐doped macroporous graphene simultaneously is reported. Four mesoporous metal oxides (WO3−
x
, Co3O4, Mn2O3, and Fe3O4) are encapsulated in N‐doped macroporous graphene. Used as an anode material for sodium‐ion hybrid supercapacitors (Na‐HSCs), mesoporous reduced tungsten oxide@N‐doped macroporous graphene (m‐WO3−
x
@NM‐rGO) gives outstanding rate capability and stable cycle life. Ex situ analyses suggest that the electrochemical reaction mechanism of m‐WO3−
x
@NM‐rGO is based on Na+ intercalation/de‐intercalation. To the best of knowledge, this is the first report on Na+ intercalation/de‐intercalation properties of WO3−
x
and its application to Na‐HSCs.
N‐doped macroporous graphene‐encapsulated mesoporous metal oxides for new energy storage systems, namely, sodium‐ion hybrid supercapacitors (Na‐HSCs), are presented. An Na‐HSC system comprising an N‐doped macroporous graphene‐encapsulated mesoporous tungsten oxide anode and an MSP‐20 cathode delivers high energy and power densities, with excellent cycling stability.
Shrimp is one of the most valuable aquaculture species globally, and the most internationally traded seafood product. Consequently, shrimp aquaculture practices have received increasing attention due ...to their high value and levels of demand, and this has contributed to economic growth in many developing countries. The global production of shrimp reached approximately 6.5 million t in 2019 and the shrimp aquaculture industry has consequently become a large-scale operation. However, the expansion of shrimp aquaculture has also been accompanied by various disease outbreaks, leading to large losses in shrimp production. Among the diseases, there are various viral diseases which can cause serious damage when compared to bacterial and fungi-based illness. In addition, new viral diseases occur rapidly, and existing diseases can evolve into new types. To address this, the review presented here will provide information on the DNA and RNA of shrimp viral diseases that have been designated by the World Organization for Animal Health and identify the latest shrimp disease trends.
Hierarchically well‐developed porous graphene nanofibers comprising N‐doped graphitic C (NGC)‐coated cobalt oxide hollow nanospheres are introduced as anodes for high‐rate Li‐ion batteries. For this, ...three strategies, comprising the Kirkendall effect, metal–organic frameworks, and compositing with highly conductive C, are applied to the 1D architecture. In particular, NGC layers are coated on cobalt oxide hollow nanospheres as a primary transport path of electrons followed by graphene‐nanonetwork‐constituting nanofibers as a continuous and secondary electron transport path. Superior cycling performance is achieved, as the unique nanostructure delivers a discharge capacity of 823 mAh g−1 after 500 cycles at 3.0 A g−1 with a low decay rate of 0.092% per cycle. The rate capability is also noteworthy as the structure exhibits high discharge capacities of 1035, 929, 847, 787, 747, 703, 672, 650, 625, 610, 570, 537, 475, 422, 294, and 222 mAh g−1 at current densities of 0.5, 1.5, 3, 5, 7, 10, 12, 15, 18, 20, 25, 30, 40, 50, 80, and 100 A g−1, respectively. In view of the highly efficient Li+ ion/electron diffusion and high structural stability, the present nanostructuring strategy has a huge potential in opening new frontiers for high‐rate and long‐lived stable energy storage systems.
Hierarchically well‐developed porous graphene nanofibers comprising N‐doped graphitic C‐coated cobalt oxide hollow nanospheres are introduced as anodes for high‐rate Li‐ion batteries. In view of the highly efficient Li+ ion/electron diffusion and high structural stability, the unique nanostructuring strategy has a huge potential in opening new frontiers for high‐rate and long‐lived stable energy storage systems.
In this work, we explore the effect of strain rate and crystallographic texture on the hardening behaviour and ductility of grade 2 commercially pure titanium (CP–Ti) plate at both room (298 K) and ...cryogenic temperature (123 K). EBSD technique was used to characterise the microstructural features and analyse the deformation twins and active slip systems in α-Ti. Using the SEM fractography, the necking resistance was estimated by measuring the reduction of cross-sectional area. As the strain rate decreases, the elongation was improved with the enhancement of strain-hardening and necking resistance, whereas this behaviour was relatively strain rate insensitive at 298 K. Consequently, the total elongations were increased from 38% (298 K) to 65% (123 K), and from 28% (298 K) to 35% (123 K) in tension parallel and transverse to the rolling direction of the plate, respectively. The combined effect of strain rate and (cryogenic) temperature affected the transition of deformation mechanisms involved in the twinning and dislocation slip, thereby leading to the three or four multi-stage strain-hardening behaviour. The results reveal that in addition to the dislocation slip, the deformation twinning contributed to the strain-hardening, and improvement of total elongation of α-titanium at cryogenic temperature.
Precast concrete (PC) structures have many advantages, but their use in the construction of middle- to high-rise buildings is limited. The construction of PC structures requires skills in various ...operations such as transportation, assembly, lifting, and structural soundness. In particular, regarding the seismic design of PC structures, it is necessary to clearly evaluate whether they have the same structural performance and usability as integral RC (cast-in-place) structures. In this paper, an experimental study was conducted to investigate whether PC members can achieve a seismic performance equivalent to that of RC members in beam–column joints, which are representative moment-resisting frames. The main variables are the two types of structural systems (intermediate and special moment-resisting frames) and the design flexural strength ratio of the columns and beams. The experimental and analytical results showed that the seismic performance of the PC specimens was equivalent to that of the RC specimens in terms of strength, stiffness, energy dissipation, and strain distribution, except for the specimen with splice sleeve bond failure of the column reinforcement (poor filling of the internal mortar). In addition, the I series satisfied the present emulation evaluation criteria for special moment-resisting frames of PC structures, confirming the possibility of applying intermediate moment-resisting frames.
Numerous marine sessile organisms adhere to ship hulls and increase the sailing resistance. Antibiofouling paints are employed to maintain the ship performance. However, the chemicals employed for ...antifouling purposes are becoming increasingly diverse, lacking clear toxicological information. Particularly, the imperfect antibiofouling efficacies of these chemicals necessitate periodic hull cleaning to dislodge attached marine organisms. This hull cleaning process inadvertently releases a plethora of hazardous substances, including antibiofouling chemicals, heavy metals, and cleaning agents, alongside exotic microorganisms. This results in profound marine pollution and ecosystem disruption. Specifically, these exotic microorganisms pose a novel ecological threat in coastal waters. However, despite the gravity of ship hull cleaning-related issues, comprehensive investigations have been lacking, and international regulatory measures are gaining attention recently. Aiming to provide solutions to the emerging challenges associated with hull cleaning, this review endeavors to comprehensively address the biofouling organisms and their mechanisms, potential antifouling paint hazards, and effective hull cleaning methodologies.
Display omitted
•Marine sessile organisms are responsible for biofouling on hull surfaces.•Regular hull cleaning is essential to remove biofouling from the hull.•Hull cleaning processes can lead to the release of pollutants into the sea.•Hull cleaning wastewater recovery and treatment are required.
We present a systematic study on the gate length (<inline-formula> <tex-math notation="LaTeX">{L}_{{g}}\text {)} </tex-math></inline-formula> scaling behavior and the impact of the side-recess ...spacing (<inline-formula> <tex-math notation="LaTeX">{L}_{\text {side}}\text {)} </tex-math></inline-formula> on dc and high-frequency characteristics of In0.8Ga0.2As quantum-well (QW) high-electron-mobility transistors (HEMTs) with <inline-formula> <tex-math notation="LaTeX">{L}_{{g}} </tex-math></inline-formula> from 10 <inline-formula> <tex-math notation="LaTeX">\mu </tex-math></inline-formula>m to 20 nm, for the purpose of understanding the scaling limit of maximum oscillation frequency (<inline-formula> <tex-math notation="LaTeX">{f}_{\text {max}}\text {)} </tex-math></inline-formula> and thereby demonstrating terahertz devices. The fabricated In0.8Ga0.2As QW HEMTs with <inline-formula> <tex-math notation="LaTeX">{L}_{{g}} =20 </tex-math></inline-formula> nm and <inline-formula> <tex-math notation="LaTeX">{L}_{\text {side}} =150 </tex-math></inline-formula> nm exhibited values of drain-induced-barrier-lowering (DIBL) of 60 mV/V, current-gain cutoff frequency (<inline-formula> <tex-math notation="LaTeX">{f}_{{T}}\text {)} </tex-math></inline-formula> of 0.75 THz, and <inline-formula> <tex-math notation="LaTeX">{f}_{\text {max}} </tex-math></inline-formula> of 1.1 THz, while the device with <inline-formula> <tex-math notation="LaTeX">{L}_{\text {side}} =50 </tex-math></inline-formula> nm showed DIBL of 110 mV/V and <inline-formula> <tex-math notation="LaTeX">{f}_{{T}} </tex-math></inline-formula>/<inline-formula> <tex-math notation="LaTeX">{f}_{\text {max}} </tex-math></inline-formula> of 0.72/0.53 THz. It was central to strictly control short-channel effects (SCEs) from the perspective of DIBL to maximize the improvement of <inline-formula> <tex-math notation="LaTeX">{f}_{\text {max}} </tex-math></inline-formula>, as <inline-formula> <tex-math notation="LaTeX">{L}_{{g}} </tex-math></inline-formula> was scaled down deeply. In an effort to understand the <inline-formula> <tex-math notation="LaTeX">{L}_{{g}} </tex-math></inline-formula> scaling behavior of <inline-formula> <tex-math notation="LaTeX">{f}_{\text {max}} </tex-math></inline-formula>, we carried out the small-signal modeling for both types of devices and found that the increase of the intrinsic output conductance (<inline-formula> <tex-math notation="LaTeX">{g}_{\text {oi}}\text {)} </tex-math></inline-formula> played a critical role in determining <inline-formula> <tex-math notation="LaTeX">{f}_{\text {max}} </tex-math></inline-formula> in short-<inline-formula> <tex-math notation="LaTeX">{L}_{{g}} </tex-math></inline-formula> HEMTs. On the contrary, the fabricated devices with <inline-formula> <tex-math notation="LaTeX">{L}_{\text {side}} =150 </tex-math></inline-formula> nm exhibited a tight control of SCEs at <inline-formula> <tex-math notation="LaTeX">{L}_{{g}} </tex-math></inline-formula> of 20 nm. As a result, <inline-formula> <tex-math notation="LaTeX">{f}_{\text {max}} </tex-math></inline-formula> in those devices was boosted to 1.1 THz, and more importantly this high <inline-formula> <tex-math notation="LaTeX">{f}_{\text {max}} </tex-math></inline-formula> was maintained even as <inline-formula> <tex-math notation="LaTeX">{L}_{{g}} </tex-math></inline-formula> was scaled down to 20 nm. The results in this work represent the best balance of <inline-formula> <tex-math notation="LaTeX">{f}_{{T}} </tex-math></inline-formula> and <inline-formula> <tex-math notation="LaTeX">{f}_{\text {max}} </tex-math></inline-formula> in any transistor technology on any material system, displaying both <inline-formula> <tex-math notation="LaTeX">{f}_{{T}} </tex-math></inline-formula> and <inline-formula> <tex-math notation="LaTeX">{f}_{\text {max}} </tex-math></inline-formula> in excess of 700 GHz simultaneously.
A selective kanamycin-binding single-strand DNA (ssDNA) aptamer (TGGGGGTTGAGGCTAAGCCGA) was discovered through in vitro selection using affinity chromatography with kanamycin-immobilized sepharose ...beads. The selected aptamer has a high affinity for kanamycin and also for kanamycin derivatives such as kanamycin B and tobramycin. The dissociation constants (
K
d kanamycin
=
78.8
nM,
K
d kanamycin B
=
84.5
nM, and
K
d tobramycin
=
103
nM) of the new aptamer were determined by fluorescence intensity analysis using 5′-fluorescein amidite (FAM) modification. Using this aptamer, kanamycin was detected down to 25
nM by the gold nanoparticle-based colorimetric method. Because the designed colorimetric method is simple, easy, and visible to the naked eye, it has advantages that make it useful for the detection of kanamycin. Furthermore, the selected new aptamer has many potential applications as a bioprobe for the detection of kanamycin, kanamycin B, and tobramycin in pharmaceutical preparations and food products.
