The Omicron lineage of SARS-CoV-2, first described in November 2021, spread rapidly to become globally dominant and has split into a number of sub-lineages. BA.1 dominated the initial wave but has ...been replaced by BA.2 in many countries. Recent sequencing from South Africa’s Gauteng region uncovered two new sub-lineages, BA.4 and BA.5 which are taking over locally, driving a new wave. BA.4 and BA.5 contain identical spike sequences and, although closely related to BA.2, contain further mutations in the receptor binding domain of spike. Here, we study the neutralization of BA.4/5 using a range of vaccine and naturally immune serum and panels of monoclonal antibodies. BA.4/5 shows reduced neutralization by serum from triple AstraZeneca or Pfizer vaccinated individuals compared to BA.1 and BA.2. Furthermore, using serum from BA.1 vaccine breakthrough infections there are likewise, significant reductions in the neutralization of BA.4/5, raising the possibility of repeat Omicron infections.
Display omitted
1.BA.4/5 resist neutralization by triple-dosed vaccinee serum more than BA.1/2.2.BA.1 vaccine breakthrough serum shows reduced neutralization of BA.4/5.3.Activity of SARS-CoV-2 therapeutic antibodies against BA.4/5 is reduced.4.L452R and F486V mutations both make major contributions to BA.4/5 escape.
SARS-CoV-2 Omicron BA.4 and BA.5 sublineages bear mutations that lead to their reduced neutralization by sera from triple vaccinated individuals when compared to the more recent BA.1 and BA.2. Importantly, sera from individuals with breakthrough BA.1 infections also show reduced neutralization, suggesting that repeat Omicron infections are likely in the population.
All Gram-negative bacteria, mitochondria and chloroplasts have outer membrane proteins (OMPs) that perform many fundamental biological processes. The OMPs in Gram-negative bacteria are inserted and ...folded into the outer membrane by the β-barrel assembly machinery (BAM). The mechanism involved is poorly understood, owing to the absence of a structure of the entire BAM complex. Here we report two crystal structures of the Escherichia coli BAM complex in two distinct states: an inward-open state and a lateral-open state. Our structures reveal that the five polypeptide transport-associated domains of BamA form a ring architecture with four associated lipoproteins, BamB-BamE, in the periplasm. Our structural, functional studies and molecular dynamics simulations indicate that these subunits rotate with respect to the integral membrane β-barrel of BamA to induce movement of the β-strands of the barrel and promote insertion of the nascent OMP.
Highly transmissible Omicron variants of SARS-CoV-2 currently dominate globally. Here, we compare neutralization of Omicron BA.1, BA.1.1, and BA.2. BA.2 RBD has slightly higher ACE2 affinity than ...BA.1 and slightly reduced neutralization by vaccine serum, possibly associated with its increased transmissibility. Neutralization differences between sub-lineages for mAbs (including therapeutics) mostly arise from variation in residues bordering the ACE2 binding site; however, more distant mutations S371F (BA.2) and R346K (BA.1.1) markedly reduce neutralization by therapeutic antibody Vir-S309. In-depth structure-and-function analyses of 27 potent RBD-binding mAbs isolated from vaccinated volunteers following breakthrough Omicron-BA.1 infection reveals that they are focused in two main clusters within the RBD, with potent right-shoulder antibodies showing increased prevalence. Selection and somatic maturation have optimized antibody potency in less-mutated epitopes and recovered potency in highly mutated epitopes. All 27 mAbs potently neutralize early pandemic strains, and many show broad reactivity with variants of concern.
Display omitted
•Potent RBD antibodies from Omicron breakthrough vaccinees broadly neutralize VoC•These, possible recall antibodies, are focused in two main clusters•Somatic maturation adapts public antibodies to recover potency•BA.2 > BA.1 ACE2 affinity. BA.2 < BA.1 neutralization by vaccine serum and Vir-S309
Analysis of antibodies from SARS-CoV-2 Omicron breakthrough infections reveals their structural and functional properties as well as ability to neutralize different pandemic strains.
Abstract
The cell surface of most Gram-negative bacteria contains lipopolysaccharide that is essential for their viability and drug resistance. A 134-kDa protein complex LptB
2
FG is unique among ...ATP-binding cassette transporters because it extracts lipopolysaccharide from the external leaflet of the inner membrane and propels it along a filament that extends across the periplasm to directly deliver lipopolysaccharide into the external leaflet of the outer membrane. Here we report the crystal structure of the lipopolysaccharide transporter LptB
2
FG from
Klebsiella pneumoniae
, in which both LptF and LptG are composed of a β-jellyroll-like periplasmic domain and six α-helical segments in the transmembrane domain. LptF and LptG form a central cavity containing highly conserved hydrophobic residues. Structural and functional studies suggest that LptB
2
FG uses an alternating lateral access mechanism to extract lipopolysaccharide and traffic it along the hydrophobic cavity toward the transporter’s periplasmic domains.
The COVID-19 pandemic has had an unprecedented health and economic impact and there are currently no approved therapies. We have isolated an antibody, EY6A, from an individual convalescing from ...COVID-19 and have shown that it neutralizes SARS-CoV-2 and cross-reacts with SARS-CoV-1. EY6A Fab binds the receptor binding domain (RBD) of the viral spike glycoprotein tightly (K
of 2 nM), and a 2.6-Å-resolution crystal structure of an RBD-EY6A Fab complex identifies the highly conserved epitope, away from the ACE2 receptor binding site. Residues within this footprint are key to stabilizing the pre-fusion spike. Cryo-EM analyses of the pre-fusion spike incubated with EY6A Fab reveal a complex of the intact spike trimer with three Fabs bound and two further multimeric forms comprising the destabilized spike attached to Fab. EY6A binds what is probably a major neutralizing epitope, making it a candidate therapeutic for COVID-19.
There are as yet no licensed therapeutics for the COVID-19 pandemic. The causal coronavirus (SARS-CoV-2) binds host cells via a trimeric spike whose receptor binding domain (RBD) recognizes ...angiotensin-converting enzyme 2, initiating conformational changes that drive membrane fusion. We find that the monoclonal antibody CR3022 binds the RBD tightly, neutralizing SARS-CoV-2, and report the crystal structure at 2.4 Å of the Fab/RBD complex. Some crystals are suitable for screening for entry-blocking inhibitors. The highly conserved, structure-stabilizing CR3022 epitope is inaccessible in the prefusion spike, suggesting that CR3022 binding facilitates conversion to the fusion-incompetent post-fusion state. Cryogenic electron microscopy (cryo-EM) analysis confirms that incubation of spike with CR3022 Fab leads to destruction of the prefusion trimer. Presentation of this cryptic epitope in an RBD-based vaccine might advantageously focus immune responses. Binders at this epitope could be useful therapeutically, possibly in synergy with an antibody that blocks receptor attachment.
Display omitted
•CR3022 binds the RBD of SARS-CoV-2 and shows strong neutralization•Neutralization is by destroying the prefusion spike conformation•CR3022 binds a highly conserved epitope that is inaccessible in prefusion spike protein•CR3022 could have therapeutic potential alone or in synergy with a receptor blocker
Huo et al. find that the antibody CR3022 binds tightly to the receptor binding domain of the SARS-CoV-2 spike at a site different to that used by the receptor. CR3022 effectively neutralizes the virus, and cryo-EM reveals that it disrupts the spike. Such antibodies could have potential as COVID-19 therapeutics.
Lipopolysaccharide (LPS) is essential for most Gram-negative bacteria and has crucial roles in protection of the bacteria from harsh environments and toxic compounds, including antibiotics. Seven LPS ...transport proteins (that is, LptA-LptG) form a trans-envelope protein complex responsible for the transport of LPS from the inner membrane to the outer membrane, the mechanism for which is poorly understood. Here we report the first crystal structure of the unique integral membrane LPS translocon LptD-LptE complex. LptD forms a novel 26-stranded β-barrel, which is to our knowledge the largest β-barrel reported so far. LptE adopts a roll-like structure located inside the barrel of LptD to form an unprecedented two-protein 'barrel and plug' architecture. The structure, molecular dynamics simulations and functional assays suggest that the hydrophilic O-antigen and the core oligosaccharide of the LPS may pass through the barrel and the lipid A of the LPS may be inserted into the outer leaflet of the outer membrane through a lateral opening between strands β1 and β26 of LptD. These findings not only help us to understand important aspects of bacterial outer membrane biogenesis, but also have significant potential for the development of novel drugs against multi-drug resistant pathogenic bacteria.
Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) has undergone progressive change, with variants conferring advantage rapidly becoming dominant lineages, e.g., B.1.617. With apparent ...increased transmissibility, variant B.1.617.2 has contributed to the current wave of infection ravaging the Indian subcontinent and has been designated a variant of concern in the United Kingdom. Here we study the ability of monoclonal antibodies and convalescent and vaccine sera to neutralize B.1.617.1 and B.1.617.2, complement this with structural analyses of Fab/receptor binding domain (RBD) complexes, and map the antigenic space of current variants. Neutralization of both viruses is reduced compared with ancestral Wuhan-related strains, but there is no evidence of widespread antibody escape as seen with B.1.351. However, B.1.351 and P.1 sera showed markedly more reduction in neutralization of B.1.617.2, suggesting that individuals infected previously by these variants may be more susceptible to reinfection by B.1.617.2. This observation provides important new insights for immunization policy with future variant vaccines in non-immune populations.
Display omitted
•Vaccine/convalescent sera show reduced neutralization of B.1.617.1 and B.1.617.2•Sera from B.1.351and P.1 show markedly reduced neutralization of B.1.617.2•B.1.351, P.1, and B.1.617.2 are antigenically divergent•Vaccines based on B.1.1.7 may protect broadly against current variants
The B.1.617 lineage of SARS-CoV-2, especially the delta strain, which is B.1.617.2, has contributed to the wave of infection in the Indian subcontinent. Structural and serological analyses show some evidence of antibody escape, and individuals infected previously with the B.1.351 (beta) and P.1 (gamma) variants are likely more susceptible to reinfection by the delta strain. Vaccines based on B.1.1.7 (alpha) are likely to provide the broadest protection against current variants.
The DNA G-quadruplex is known for forming a range of topologies and for the observed lability of the assembly, consistent with its transient formation in live cells. The stabilization of a particular ...topology by a small molecule is of great importance for therapeutic applications. Here, we show that the ruthenium complex Λ-Ru(phen)
(qdppz)
displays enantiospecific G-quadruplex binding. It crystallized in 1:1 stoichiometry with a modified human telomeric G-quadruplex sequence, GGGTTAGGGTTAGGGTTTGGG (
T
), in an antiparallel chair topology, the first structurally characterized example of ligand binding to this topology. The lambda complex is bound in an intercalation cavity created by a terminal G-quartet and the central narrow lateral loop formed by T
-T
-A
. The two remaining wide lateral loops are linked through a third K
ion at the other end of the G-quartet stack, which also coordinates three thymine residues. In a comparative ligand-binding study, we showed, using a Klenow fragment assay, that this complex is the strongest observed inhibitor of replication, both using the native human telomeric sequence and the modified sequence used in this work.
PDF
