Summary
The bacterium Streptomyces davaonensis synthesizes the antibiotic roseoflavin in the stationary phase of growth. The starting point for roseoflavin biosynthesis is riboflavin (vitamin B2) and ...four enzymes (RibCF, RosB, RosA and RosC) are necessary to convert a vitamin (riboflavin) into a potent, broad‐spectrum antibiotic (roseoflavin). In S. davaonensis, seven enzymatic functions are required to synthesize the roseoflavin precursor riboflavin from the central building blocks GTP and ribulose 5‐phosphate. When compared with other bacterial and in particular Streptomyces genomes the S. davaonensis genome contains an unusual high number (21) of putative riboflavin biosynthetic genes (rib genes), including a rib gene encoding an additional riboflavin synthase originating from an Archaeon. We show by complementation analyses and enzyme assays that 17 out of these 21 putative rib genes indeed encode for riboflavin biosynthetic enzymes. Biochemical analyses of selected enzymes support this finding. Transcriptome analyses show that all of the rib genes are expressed either in the exponential or in the stationary phase of growth and thus do not represent silent genes. We conclude that the Rib enzymes produced in the stationary phase represent a physiological adaptation to support roseoflavin biosynthesis.
•A cost-effective method of producing poly(ε-lysine) was developed.•Pretreated cane molasses was used as carbon source to replace glucose.•Hydrolysate of streptomyces cells was used to replace yeast ...extract.•The production in this article is a green, economical and effective process.
Poly(ε-l-lysine) (ε-PL) and poly(l-diaminopropionic acid) (PDAP) co-production by Streptomyces albulus PD-1 from cane molasses and hydrolysate of strepyomyces cells (HSC) was investigated for the first time in this study. The optimal initial total sugar concentration of the cane molasses pretreated with sulfuric acid was determined to be 20gL−1, and HSC could substitute for yeast extract for ε-PL and PDAP co-production. When fed-batch fermentation was performed in 1t fermentor with pretreated cane molasses and HSC, 20.6±0.5gL−1 of ε-PL and 5.2±0.6gL−1 of PDAP were obtained. The amount of strepyomyces cells obtained in one fed-batch fermentation is sufficient to prepare the HSC to satisfy the demand of subsequent fermentations, thus the self-cycling of organic nitrogen source becomes available. These results suggest that the low-cost cane molasses and HSC can be used for the economical production of ε-PL and PDAP by S. albulus PD-1.
Arterial/venous thrombosis is the major cardiovascular disorder accountable for substantial mortality; and the current demand for antithrombotic agents is extensive. Heparinases depolymerize ...unfractionated heparin (UFH) for the production of low molecular-weight heparins (LMWHs; used as anticoagulants against thrombosis). A microbial strain of Streptomyces sp. showing antithrombotic activity was isolated from the soil sample collected from north India. The strain was characterized by using 16S rRNA homology technique and identified as Streptomyces variabilis MTCC 12266 capable of producing heparinase enzyme. This is the very first communication reporting Streptomyces genus as the producer of heparinase. It was observed that the production of intracellular heparinase was 63.8 U/mg protein (specific activity) 1.58 folds higher compared to extracellular heparinase 40.28 U/mg protein. DEAE-Sephadex A-50 column followed by Sepharose-6B column purification of the crude protein resulted 19.18 folds purified heparinase. SDS-PAGE analysis of heparinase resulted an estimated molecular-weight of 42 kDa. It was also found that intracellular heparinase has the ability to depolymerize heparin to generate LMWHs. Further studies related to the mechanistic action, structural details, and genomics involved in heparinase production from Streptomyces variabilis are warranted for large scale production/purification optimization of heparinase for antithrombotic applications.
The DNA region encoding the filipin gene cluster in Streptomyces avermitilis (pte) contains a PAS-LuxR regulatory gene, pteF, orthologue to pimM, the final pathway-specific positive regulatory ...protein of pimaricin biosynthesis in Streptomyces natalensis. Gene replacement of the gene from S. avermitilis chromosome resulted in a severe loss of filipin production and delayed spore formation in comparison to that of the wild-type strain, suggesting that it acts as a positive regulator of filipin biosynthesis and that it may also have a role in sporulation. Complementation of the mutant with a single copy of the gene integrated into the chromosome restored wild-type phenotypes. Heterologous complementation with the regulatory counterpart from S. natalensis also restored parental phenotypes. Gene expression analyses in S. avermitilis wild-type and the mutant by reverse transcription-quantitative polymerase chain reaction of the filipin gene cluster suggested the targets for the regulatory protein. Transcription start points of all the genes of the cluster were studied by 5′-rapid amplification of complementary DNA ends. Transcription start point analysis of the pteF gene revealed that the annotated sequence in the databases is incorrect. Confirmation of target promoters was performed by in silico search of binding sites among identified promoters and the binding of the orthologous regulator for pimaricin biosynthesis PimM to gene promoters by electrophoretic mobility shift assays. Precise binding regions were investigated by DNAse I protection studies. Our results indicate that PteF activates the transcription from two promoters of polyketide synthase genes directly, and indirectly of other genes of the cluster.
Thioviridamide is a structurally novel ribosomally synthesized and post-translational modified peptide (RiPP) produced by Streptomyces olivoviridis NA005001. It is characterized by a structure that ...features a series of thioamide groups and possesses potent antiproliferative activity in cancer cell lines. Its unusual structure allied to its promise as an anticancer compound led us to investigate the diversity of thioviridamide-like pathways across sequenced bacterial genomes. We have isolated and characterized three diverse members of this family of natural products. This characterization is supported by transformation-associated recombination cloning and heterologous expression of one of these compounds, thiostreptamide S4. Our work provides an insight into the diversity of this rare class of compound and indicates that the unusual N-terminus of thioviridamide is not introduced biosynthetically but is instead introduced during acetone extraction. A detailed analysis of the biological activity of one of the newly discovered compounds, thioalbamide, indicates that it is highly cytotoxic to cancer cells, while exhibiting significantly less activity toward a noncancerous epithelial cell line.
and
constitute model strains to study the regulation of antibiotics biosynthesis in
species since these closely related strains possess the same pathways directing the biosynthesis of various ...antibiotics but only
produces them. To get a better understanding of the origin of the contrasted abilities of these strains to produce bioactive specialized metabolites, these strains were grown in conditions of phosphate limitation or proficiency and a comparative analysis of their transcriptional/regulatory proteins was carried out. The abundance of the vast majority of the 355 proteins detected greatly differed between these two strains and responded differently to phosphate availability. This study confirmed, consistently with previous studies, that
suffers from nitrogen stress. This stress likely triggers the degradation of the nitrogen-rich peptidoglycan cell wall in order to recycle nitrogen present in its constituents, resulting in cell wall stress. When an altered cell wall is unable to fulfill its osmo-protective function, the bacteria also suffer from osmotic stress. This study thus revealed that these three stresses are intimately linked in
. The aggravation of these stresses leading to an increase of antibiotic biosynthesis, the connection between these stresses, and antibiotic production are discussed.
Summary
Members of the soil‐dwelling, sporulating prokaryotic genus Streptomyces are indispensable for the recycling of the most abundant polysaccharides on earth (cellulose and chitin), and produce ...a wide range of antibiotics and industrial enzymes. How do these organisms sense the nutritional state of the environment, and what controls the signal for the switch to antibiotic production and morphological development? Here we show that high extracellular concentrations of N‐acetylglucosamine, the monomer of chitin, prevent Streptomyces coelicolor progressing beyond the vegetative state, and that this effect is absent in a mutant defective of N‐acetylglucosamine transport. We provide evidence that the signal is transmitted through the GntR‐family regulator DasR, which controls the N‐acetylglucosamine regulon, including the pts genes ptsH, ptsI and crr needed for uptake of N‐acetylglucosamine. Deletion of dasR or the pts genes resulted in a bald phenotype. Binding of DasR to its target genes is abolished by glucosamine 6‐phosphate, a central molecule in N‐acetylglucosamine metabolism. Extracellular complementation experiments with many bld mutants showed that the dasR mutant is arrested at an early stage of the developmental programme, and does not fit in the previously described bld signalling cascade. Thus, for the first time we are able to directly link carbon (and nitrogen) metabolism to development, highlighting a novel type of metabolic regulator, which senses the nutritional state of the habitat, maintaining vegetative growth until changing circumstances trigger the switch to sporulation. Our work, and the model it suggests, provide new leads towards understanding how microorganisms time developmental commitment.
At the high concentrations used in medicine, antibiotics exert strong selection on bacterial populations for the evolution of resistance. However, these lethal concentrations may not be ...representative of the concentrations bacteria face in soil, a recognition that has led to questions of the role of antibiotics in soil environments as well as the dynamics of resistance evolution during sublethal challenge. Here we examine the evolution of resistance to sub-minimal inhibitory concentrations (sub-MIC) of streptomycin in the filamentous soil bacterium Streptomyces coelicolor. First, we show that spontaneous resistance to streptomycin causes an average fitness deficit of ~21% in the absence of drugs; however, these costs are eliminated at concentrations as low as 1/10 the MIC of susceptible strains. Using experimental evolution, we next show that resistance to >MIC levels of streptomycin readily evolves when bacteria are exposed to sub-MIC doses for 500 generations. Furthermore, the resistant clones that evolved at sub-MIC streptomycin concentrations carry no fitness cost. Whole-genome analyses reveal that evolved resistant clones fixed some of the same mutations as those isolated at high drug concentrations; however, all evolved clones carry additional mutations and some fixed mutations that either compensate for costly resistance or have no associated fitness costs. Our results broaden the conditions under which resistance can evolve in nature and suggest that rather than low-concentration antibiotics acting as signals, resistance evolves in response to antibiotics used as weapons.
Formycin A is a potent purine nucleoside antibiotic with a C-glycosidic linkage between the ribosyl moiety and the pyrazolopyrimidine base. Herein, a cosmid is identified from the Streptomyces ...kaniharaensis genome library that contains the for gene cluster responsible for the biosynthesis of formycin. Subsequent gene deletion experiments and in vitro characterization of the forBCH gene products established their catalytic functions in formycin biosynthesis. Results also demonstrated that PurH from de novo purine biosynthesis plays a key role in pyrazolopyrimidine formation during biosynthesis of formycin A. The participation of PurH in both pathways represents a good example of how primary and secondary metabolism are interlinked.
Daptomycin produced by Streptomyces roseosporus is an important lipopeptide antibiotic used to treat human infections caused by Gram-positive pathogenic bacteria, including drug-resistant strains. ...The genetic basis for regulatory mechanisms of daptomycin production is poorly known. Here, we characterized the dptR3 gene, which encodes a MarR family transcriptional regulator located adjacent to the known daptomycin biosynthetic (dpt) genes. Deletion of dptR3 reduced daptomycin production significantly and delayed aerial mycelium formation and sporulation on solid media. Dissection of the mechanism underlying the function of DptR3 in daptomycin production revealed that it stimulates daptomycin production indirectly by altering the transcription of dpt structural genes. DptR3 directly activated the transcription of its own gene, dptR3, but repressed the transcription of the adjacent, divergent gene orf16 (which encodes a putative ABC transporter ATP-binding protein). A 66-nucleotide DptR3-binding site in the intergenic region of dptR3-orf16 was determined by DNase I footprinting, and the palindromic sequence TCATTGTTACCTATGCTCACAATGA (underlining indicates inverted repeats) in the protected region was found to be essential for DptR3 binding. orf16, the major target gene of DptR3, exerted a positive effect on daptomycin biosynthesis. Our findings indicate that DptR3 functions as a global regulator that positively controls daptomycin production and morphological development in S. roseosporus.
PDF
